EMAIL THIS PAGE TO A FRIEND

CEP85

centrosomal protein 85kDa

70 Gene Product Result for
Synonyms: CCDC21
Gene ID:
Mouse(70012) centrosomal protein 85
Rat(362622) centrosomal protein 85kDa
chicken(419547) centrosomal protein 85kDa
domestic cat(101085390) centrosomal protein 85kDa
cow(517520) centrosomal protein 85kDa
Horse(100071140) centrosomal protein 85kDa
dog(487357) centrosomal protein 85kDa
sheep(101112118) centrosomal protein 85kDa
Domestic Rabbit(100345601) centrosomal protein 85kDa
naked mole-rat(101708778) centrosomal protein 85kDa
domestic guinea pig(100730643) centrosomal protein 85kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022778 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065171 MISSION® esiRNA esiRNA human CCDC21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022778 Rosetta Predictions human pricing
NM_001080151 Rosetta Predictions rat pricing
NM_144527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203755 predicted 1397
2 SASI_Hs01_00203756 predicted 404
3 SASI_Hs01_00203757 predicted 1908
4 SASI_Hs01_00203758 predicted 709
5 SASI_Hs01_00203760 predicted 479
6 SASI_Hs01_00203761 predicted 1020
7 SASI_Hs01_00203762 predicted 1713
8 SASI_Hs01_00203763 predicted 1455
9 SASI_Hs01_00203764 predicted 1331
10 SASI_Hs02_00356072 predicted 2347
11 SASI_Hs01_00203759 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208439 predicted 708
2 SASI_Rn02_00208440 predicted 1788
3 SASI_Rn02_00208441 predicted 2095
4 SASI_Rn02_00208442 predicted 1966
5 SASI_Rn02_00208443 predicted 595
6 SASI_Rn02_00208444 predicted 1672
7 SASI_Rn02_00208445 predicted 1716
8 SASI_Rn02_00208446 predicted 928
9 SASI_Rn02_00208447 predicted 1553
10 SASI_Rn02_00208448 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089631 predicted 741
2 SASI_Mm01_00089632 predicted 2260
3 SASI_Mm01_00089633 predicted 2332
4 SASI_Mm01_00089634 predicted 789
5 SASI_Mm02_00340046 predicted 741
6 SASI_Mm02_00340047 predicted 342
7 SASI_Mm01_00089635 predicted 1803
8 SASI_Mm01_00089636 predicted 1790
9 SASI_Mm01_00089637 predicted 1030
10 SASI_Mm01_00089638 predicted 1641
11 SASI_Mm01_00089639 predicted 986
12 SASI_Mm01_00089640 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144527
VALIDATED
CEP85 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 85kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144527.3-1648s21c1
Sequence:CCGGCAGCTTAAGGACGCTGAATTACTCGAGTAATTCAGCGTCCTTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144527.3-3315s21c1
Sequence:CCGGGTTCGGAGCACCTAAGATAAACTCGAGTTTATCTTAGGTGCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-730s21c1
Sequence:CCGGGCCATGCTAGAGACGTTATACCTCGAGGTATAACGTCTCTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-1495s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144527.2-3455s1c1
Sequence:CCGGCCTGTATGTATGAGGAGTAAACTCGAGTTTACTCCTCATACATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-2213s1c1
Sequence:CCGGCACAATCCTAACCTCTCACTACTCGAGTAGTGAGAGGTTAGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-985s1c1
Sequence:CCGGGCAGTTGGAATTGATCCGTTTCTCGAGAAACGGATCAATTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144527
VALIDATED
CEP85 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 85kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144527.3-1648s21c1
Sequence:CCGGCAGCTTAAGGACGCTGAATTACTCGAGTAATTCAGCGTCCTTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144527.3-3315s21c1
Sequence:CCGGGTTCGGAGCACCTAAGATAAACTCGAGTTTATCTTAGGTGCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-730s21c1
Sequence:CCGGGCCATGCTAGAGACGTTATACCTCGAGGTATAACGTCTCTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-1495s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144527.2-3455s1c1
Sequence:CCGGCCTGTATGTATGAGGAGTAAACTCGAGTTTACTCCTCATACATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-2213s1c1
Sequence:CCGGCACAATCCTAACCTCTCACTACTCGAGTAGTGAGAGGTTAGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-985s1c1
Sequence:CCGGGCAGTTGGAATTGATCCGTTTCTCGAGAAACGGATCAATTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144527
VALIDATED
CEP85 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 85kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144527.3-1648s21c1
Sequence:CCGGCAGCTTAAGGACGCTGAATTACTCGAGTAATTCAGCGTCCTTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144527.3-3315s21c1
Sequence:CCGGGTTCGGAGCACCTAAGATAAACTCGAGTTTATCTTAGGTGCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-730s21c1
Sequence:CCGGGCCATGCTAGAGACGTTATACCTCGAGGTATAACGTCTCTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144527.3-1495s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144527.2-3455s1c1
Sequence:CCGGCCTGTATGTATGAGGAGTAAACTCGAGTTTACTCCTCATACATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-2213s1c1
Sequence:CCGGCACAATCCTAACCTCTCACTACTCGAGTAGTGAGAGGTTAGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144527.2-985s1c1
Sequence:CCGGGCAGTTGGAATTGATCCGTTTCTCGAGAAACGGATCAATTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022778
VALIDATED
CEP85 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 85kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-997s21c1
Sequence:GTACCGGAGCTGGAATTGATTCGTTTACCTCGAGGTAAACGAATCAATTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-705s21c1
Sequence:GTACCGGGCAATGATGGAGACACTTTATCTCGAGATAAAGTGTCTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-2626s21c1
Sequence:CCGGTCTCGACGGTGAGTTACTAATCTCGAGATTAGTAACTCACCGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-2341s21c1
Sequence:CCGGGTCGTGACATTGAGGACTTAACTCGAGTTAAGTCCTCAATGTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-1470s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022778.2-2726s1c1
Sequence:CCGGCCACCTTTCTTCTCCATCCAACTCGAGTTGGATGGAGAAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022778.2-3046s1c1
Sequence:CCGGCCATGCCATTTAACAAGAGATCTCGAGATCTCTTGTTAAATGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-658s1c1
Sequence:CCGGCGAGGAAGTTTGATATTCCTACTCGAGTAGGAATATCAAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-1625s1c1
Sequence:CCGGGCTTAAGGATTCTGAGTTGAACTCGAGTTCAACTCAGAATCCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-995s1c1
Sequence:CCGGGCAGCTGGAATTGATTCGTTTCTCGAGAAACGAATCAATTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-1716s1c1
Sequence:CCGGGAGAAGGAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-767s1c1
Sequence:CCGGCAGCACAAGTAAGGAGTTGTACTCGAGTACAACTCCTTACTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022778.2-407s1c1
Sequence:CCGGCCATGTGATGCCTTCTACTTTCTCGAGAAAGTAGAAGGCATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022778
VALIDATED
CEP85 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 85kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-997s21c1
Sequence:GTACCGGAGCTGGAATTGATTCGTTTACCTCGAGGTAAACGAATCAATTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-705s21c1
Sequence:GTACCGGGCAATGATGGAGACACTTTATCTCGAGATAAAGTGTCTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-2626s21c1
Sequence:CCGGTCTCGACGGTGAGTTACTAATCTCGAGATTAGTAACTCACCGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-2341s21c1
Sequence:CCGGGTCGTGACATTGAGGACTTAACTCGAGTTAAGTCCTCAATGTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-1470s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022778.2-2726s1c1
Sequence:CCGGCCACCTTTCTTCTCCATCCAACTCGAGTTGGATGGAGAAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022778.2-3046s1c1
Sequence:CCGGCCATGCCATTTAACAAGAGATCTCGAGATCTCTTGTTAAATGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-658s1c1
Sequence:CCGGCGAGGAAGTTTGATATTCCTACTCGAGTAGGAATATCAAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-1625s1c1
Sequence:CCGGGCTTAAGGATTCTGAGTTGAACTCGAGTTCAACTCAGAATCCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-995s1c1
Sequence:CCGGGCAGCTGGAATTGATTCGTTTCTCGAGAAACGAATCAATTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-1716s1c1
Sequence:CCGGGAGAAGGAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-767s1c1
Sequence:CCGGCAGCACAAGTAAGGAGTTGTACTCGAGTACAACTCCTTACTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022778.2-407s1c1
Sequence:CCGGCCATGTGATGCCTTCTACTTTCTCGAGAAAGTAGAAGGCATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022778
VALIDATED
CEP85 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 85kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-997s21c1
Sequence:GTACCGGAGCTGGAATTGATTCGTTTACCTCGAGGTAAACGAATCAATTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-705s21c1
Sequence:GTACCGGGCAATGATGGAGACACTTTATCTCGAGATAAAGTGTCTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022778.2-2626s21c1
Sequence:CCGGTCTCGACGGTGAGTTACTAATCTCGAGATTAGTAACTCACCGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-2341s21c1
Sequence:CCGGGTCGTGACATTGAGGACTTAACTCGAGTTAAGTCCTCAATGTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022778.2-1470s21c1
Sequence:CCGGAGGGTCAAAGGTCGTGATAAACTCGAGTTTATCACGACCTTTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022778.2-2726s1c1
Sequence:CCGGCCACCTTTCTTCTCCATCCAACTCGAGTTGGATGGAGAAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022778.2-3046s1c1
Sequence:CCGGCCATGCCATTTAACAAGAGATCTCGAGATCTCTTGTTAAATGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-658s1c1
Sequence:CCGGCGAGGAAGTTTGATATTCCTACTCGAGTAGGAATATCAAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-1625s1c1
Sequence:CCGGGCTTAAGGATTCTGAGTTGAACTCGAGTTCAACTCAGAATCCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022778.2-995s1c1
Sequence:CCGGGCAGCTGGAATTGATTCGTTTCTCGAGAAACGAATCAATTCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-1716s1c1
Sequence:CCGGGAGAAGGAGATTCAACTGGAACTCGAGTTCCAGTTGAATCTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022778.2-767s1c1
Sequence:CCGGCAGCACAAGTAAGGAGTTGTACTCGAGTACAACTCCTTACTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022778.2-407s1c1
Sequence:CCGGCCATGTGATGCCTTCTACTTTCTCGAGAAAGTAGAAGGCATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks