EMAIL THIS PAGE TO A FRIEND

CEP85L

centrosomal protein 85kDa-like

90 Gene Product Result for
Synonyms: C6orf204 NY-BR-15 bA57K17.2
Gene ID:
Human(387119) Summary: The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(100038725) centrosomal protein 85-like
Rat(100361627) centrosomal protein 85-like
domestic guinea pig(100733376) centrosomal protein 85kDa-like
naked mole-rat(101700235) centrosomal protein 85kDa-like
sheep(101103576) centrosomal protein 85kDa-like
Zebrafish(555436) centrosomal protein 85, like
cow(537625) centrosomal protein 85kDa-like
domestic cat(101098712) centrosomal protein 85kDa-like
chicken(100857774) centrosomal protein 85kDa-like
dog(100687154) centrosomal protein 85kDa-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116221 MISSION® esiRNA esiRNA human C6orf204 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042475 Rosetta Predictions human pricing
NM_206921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310028 predicted 1541
2 SASI_Hs02_00310029 predicted 744
3 SASI_Hs02_00310030 predicted 1706
4 SASI_Hs02_00310031 predicted 1178
5 SASI_Hs02_00310032 predicted 722
6 SASI_Hs02_00310033 predicted 792
7 SASI_Hs02_00310034 predicted 1568
8 SASI_Hs02_00310035 predicted 888
9 SASI_Hs02_00310036 predicted 1636
10 SASI_Hs02_00310037 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056923 predicted 1541
2 SASI_Hs02_00373612 predicted 736
3 SASI_Hs01_00056924 predicted 1705
4 SASI_Hs02_00373613 predicted 810
5 SASI_Hs02_00373614 predicted 716
6 SASI_Hs02_00373615 predicted 784
7 SASI_Hs01_00056927 predicted 1575
8 SASI_Hs01_00056929 predicted 976
9 SASI_Hs02_00373616 predicted 884
10 SASI_Hs01_00056931 predicted 1641
11 SASI_Hs01_00056925 predicted 1279
12 SASI_Hs01_00056926 predicted 1427
13 SASI_Hs01_00056928 predicted 1296
14 SASI_Hs01_00056930 predicted 361
15 SASI_Hs01_00056932 predicted 1285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206921
CEP85L MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 85kDa-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1389s1c1
Sequence:CCGGGCATCTACTGAGAAAGAAGTTCTCGAGAACTTCTTTCTCAGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1086s1c1
Sequence:CCGGCAAAGTTATTCACCTGGCTATCTCGAGATAGCCAGGTGAATAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-886s21c1
Sequence:CCGGGCCCATGTGATGCCGTCTAATCTCGAGATTAGACGGCATCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206921.2-2130s21c1
Sequence:CCGGATTTATGTGGAGGTGATTAATCTCGAGATTAATCACCTCCACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-827s21c1
Sequence:CCGGCAACTTCAAGTGGCACATTATCTCGAGATAATGTGCCACTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-723s21c1
Sequence:CCGGTCCATCTAACCATCGAAATAACTCGAGTTATTTCGATGGTTAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-1338s21c1
Sequence:CCGGGCCTGTAGACATGACATATAGCTCGAGCTATATGTCATGTCTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206921
CEP85L MISSION shRNA shRNA Plasmid DNA
centrosomal protein 85kDa-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1389s1c1
Sequence:CCGGGCATCTACTGAGAAAGAAGTTCTCGAGAACTTCTTTCTCAGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1086s1c1
Sequence:CCGGCAAAGTTATTCACCTGGCTATCTCGAGATAGCCAGGTGAATAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-886s21c1
Sequence:CCGGGCCCATGTGATGCCGTCTAATCTCGAGATTAGACGGCATCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206921.2-2130s21c1
Sequence:CCGGATTTATGTGGAGGTGATTAATCTCGAGATTAATCACCTCCACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-827s21c1
Sequence:CCGGCAACTTCAAGTGGCACATTATCTCGAGATAATGTGCCACTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-723s21c1
Sequence:CCGGTCCATCTAACCATCGAAATAACTCGAGTTATTTCGATGGTTAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-1338s21c1
Sequence:CCGGGCCTGTAGACATGACATATAGCTCGAGCTATATGTCATGTCTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206921
CEP85L MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 85kDa-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1389s1c1
Sequence:CCGGGCATCTACTGAGAAAGAAGTTCTCGAGAACTTCTTTCTCAGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206921.1-1086s1c1
Sequence:CCGGCAAAGTTATTCACCTGGCTATCTCGAGATAGCCAGGTGAATAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-886s21c1
Sequence:CCGGGCCCATGTGATGCCGTCTAATCTCGAGATTAGACGGCATCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206921.2-2130s21c1
Sequence:CCGGATTTATGTGGAGGTGATTAATCTCGAGATTAATCACCTCCACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-827s21c1
Sequence:CCGGCAACTTCAAGTGGCACATTATCTCGAGATAATGTGCCACTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-723s21c1
Sequence:CCGGTCCATCTAACCATCGAAATAACTCGAGTTATTTCGATGGTTAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206921.2-1338s21c1
Sequence:CCGGGCCTGTAGACATGACATATAGCTCGAGCTATATGTCATGTCTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks