EMAIL THIS PAGE TO A FRIEND

CEP89

centrosomal protein 89kDa

58 Gene Product Result for
Synonyms: CCDC123
UniProtKB ID: Q96ST8, B9EGA6, Q8N5J8
Gene ID:
Mouse(72140) centrosomal protein 89
Rat(292811) centrosomal protein 89kDa
Zebrafish(393852) centrosomal protein 89
dog(476497) centrosomal protein 89kDa
cow(512749) centrosomal protein 89kDa
Horse(100056114) centrosomal protein 89kDa
chicken(415769) centrosomal protein 89kDa
sheep(101109823) centrosomal protein 89kDa
naked mole-rat(101713998) centrosomal protein 89kDa
domestic guinea pig(100724553) centrosomal protein 89kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032816 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032816 Rosetta Predictions human pricing
NM_001127599 Rosetta Predictions rat pricing
XM_214901 Rosetta Predictions rat pricing
NM_028120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231370 predicted 945
2 SASI_Hs01_00231371 predicted 2252
3 SASI_Hs01_00231372 predicted 679
4 SASI_Hs01_00231373 predicted 1191
5 SASI_Hs01_00231375 predicted 967
6 SASI_Hs01_00231376 predicted 1202
7 SASI_Hs02_00360396 predicted 1614
8 SASI_Hs01_00231377 predicted 837
9 SASI_Hs01_00231378 predicted 1945
10 SASI_Hs02_00360397 predicted 540
11 SASI_Hs01_00231369 predicted 1617
12 SASI_Hs01_00231374 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254590 predicted 1212
2 SASI_Rn02_00254591 predicted 1234
3 SASI_Rn02_00254592 predicted 1415
4 SASI_Rn02_00254593 predicted 259
5 SASI_Rn02_00254594 predicted 1578
6 SASI_Rn02_00254595 predicted 1881
7 SASI_Rn02_00254596 predicted 1988
8 SASI_Rn02_00254597 predicted 1313
9 SASI_Rn02_00254598 predicted 1149
10 SASI_Rn02_00254599 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154101 predicted 310
2 SASI_Rn01_00154102 predicted 278
3 SASI_Rn01_00154103 predicted 303
4 SASI_Rn01_00154104 predicted 273
5 SASI_Rn01_00154105 predicted 303
6 SASI_Rn01_00154106 predicted 295
7 SASI_Rn01_00154107 predicted 318
8 SASI_Rn01_00154108 predicted 290
9 SASI_Rn01_00154109 predicted 318
10 SASI_Rn01_00154110 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053202 predicted 284
2 SASI_Mm01_00053203 predicted 1919
3 SASI_Mm01_00053204 predicted 1170
4 SASI_Mm02_00333378 predicted 1251
5 SASI_Mm01_00053206 predicted 1455
6 SASI_Mm01_00053207 predicted 876
7 SASI_Mm01_00053208 predicted 1390
8 SASI_Mm01_00053209 predicted 873
9 SASI_Mm01_00053210 predicted 1927
10 SASI_Mm01_00053211 predicted 1355
11 SASI_Mm01_00053205 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028120
VALIDATED
CEP89 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 89kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1145s21c1
Sequence:CCGGCACCCTGGTTGGTGGATATAACTCGAGTTATATCCACCAACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-748s21c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.2-1032s1c1
Sequence:CCGGGATGATTGTCCATCGATTGAACTCGAGTTCAATCGATGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1297s21c1
Sequence:CCGGTTGCACCAAGAGTTAACTAAGCTCGAGCTTAGTTAACTCTTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-2365s21c1
Sequence:CCGGCTACTGATTGGCCATGATTTCCTCGAGGAAATCATGGCCAATCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-397s21c1
Sequence:CCGGGAGCCGAGAAGGACGTCATTACTCGAGTAATGACGTCCTTCTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1923s1c1
Sequence:CCGGCCAAGGAACGAGACAGTCTTACTCGAGTAAGACTGTCTCGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1457s1c1
Sequence:CCGGGACGTTTCTAAGCTGACTAAACTCGAGTTTAGTCAGCTTAGAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-750s1c1
Sequence:CCGGCTGGTAGAATACATCAAAGATCTCGAGATCTTTGATGTATTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-749s1c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-868s1c1
Sequence:CCGGGAGACAGGCAATGAAGGACTTCTCGAGAAGTCCTTCATTGCCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-1832s1c1
Sequence:CCGGGTCCTCAGAAAGCAAGTAGAACTCGAGTTCTACTTGCTTTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028120
VALIDATED
CEP89 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 89kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1145s21c1
Sequence:CCGGCACCCTGGTTGGTGGATATAACTCGAGTTATATCCACCAACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-748s21c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.2-1032s1c1
Sequence:CCGGGATGATTGTCCATCGATTGAACTCGAGTTCAATCGATGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1297s21c1
Sequence:CCGGTTGCACCAAGAGTTAACTAAGCTCGAGCTTAGTTAACTCTTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-2365s21c1
Sequence:CCGGCTACTGATTGGCCATGATTTCCTCGAGGAAATCATGGCCAATCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-397s21c1
Sequence:CCGGGAGCCGAGAAGGACGTCATTACTCGAGTAATGACGTCCTTCTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1923s1c1
Sequence:CCGGCCAAGGAACGAGACAGTCTTACTCGAGTAAGACTGTCTCGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1457s1c1
Sequence:CCGGGACGTTTCTAAGCTGACTAAACTCGAGTTTAGTCAGCTTAGAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-750s1c1
Sequence:CCGGCTGGTAGAATACATCAAAGATCTCGAGATCTTTGATGTATTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-749s1c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-868s1c1
Sequence:CCGGGAGACAGGCAATGAAGGACTTCTCGAGAAGTCCTTCATTGCCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-1832s1c1
Sequence:CCGGGTCCTCAGAAAGCAAGTAGAACTCGAGTTCTACTTGCTTTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028120
VALIDATED
CEP89 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 89kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1145s21c1
Sequence:CCGGCACCCTGGTTGGTGGATATAACTCGAGTTATATCCACCAACCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-748s21c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.2-1032s1c1
Sequence:CCGGGATGATTGTCCATCGATTGAACTCGAGTTCAATCGATGGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-1297s21c1
Sequence:CCGGTTGCACCAAGAGTTAACTAAGCTCGAGCTTAGTTAACTCTTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-2365s21c1
Sequence:CCGGCTACTGATTGGCCATGATTTCCTCGAGGAAATCATGGCCAATCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028120.2-397s21c1
Sequence:CCGGGAGCCGAGAAGGACGTCATTACTCGAGTAATGACGTCCTTCTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1923s1c1
Sequence:CCGGCCAAGGAACGAGACAGTCTTACTCGAGTAAGACTGTCTCGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028120.1-1457s1c1
Sequence:CCGGGACGTTTCTAAGCTGACTAAACTCGAGTTTAGTCAGCTTAGAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-750s1c1
Sequence:CCGGCTGGTAGAATACATCAAAGATCTCGAGATCTTTGATGTATTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028120.1-749s1c1
Sequence:CCGGGCTGGTAGAATACATCAAAGACTCGAGTCTTTGATGTATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-868s1c1
Sequence:CCGGGAGACAGGCAATGAAGGACTTCTCGAGAAGTCCTTCATTGCCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028120.1-1832s1c1
Sequence:CCGGGTCCTCAGAAAGCAAGTAGAACTCGAGTTCTACTTGCTTTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032816
CEP89 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 89kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1113s1c1
Sequence:CCGGGAAGAGGTAACGTTTCCGATTCTCGAGAATCGGAAACGTTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-427s1c1
Sequence:CCGGCTTCTTTGCCATCCTTTGAAACTCGAGTTTCAAAGGATGGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-771s1c1
Sequence:CCGGGCACGTCAAAGATATACAGAACTCGAGTTCTGTATATCTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-753s1c1
Sequence:CCGGCCAGATATAACTGGTAGAGCACTCGAGTGCTCTACCAGTTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1119s1c1
Sequence:CCGGGTAACGTTTCCGATTGTGAAACTCGAGTTTCACAATCGGAAACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-584s1c1
Sequence:CCGGGCCATTGTTACATGAGGTGAACTCGAGTTCACCTCATGTAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-978s1c1
Sequence:CCGGGCTGCACCTGAATTACTTTATCTCGAGATAAAGTAATTCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-116s1c1
Sequence:CCGGCAGGAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-1064s1c1
Sequence:CCGGGAATGTAGAACTCAGTCGATACTCGAGTATCGACTGAGTTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032816
CEP89 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 89kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1113s1c1
Sequence:CCGGGAAGAGGTAACGTTTCCGATTCTCGAGAATCGGAAACGTTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-427s1c1
Sequence:CCGGCTTCTTTGCCATCCTTTGAAACTCGAGTTTCAAAGGATGGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-771s1c1
Sequence:CCGGGCACGTCAAAGATATACAGAACTCGAGTTCTGTATATCTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-753s1c1
Sequence:CCGGCCAGATATAACTGGTAGAGCACTCGAGTGCTCTACCAGTTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1119s1c1
Sequence:CCGGGTAACGTTTCCGATTGTGAAACTCGAGTTTCACAATCGGAAACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-584s1c1
Sequence:CCGGGCCATTGTTACATGAGGTGAACTCGAGTTCACCTCATGTAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-978s1c1
Sequence:CCGGGCTGCACCTGAATTACTTTATCTCGAGATAAAGTAATTCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-116s1c1
Sequence:CCGGCAGGAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-1064s1c1
Sequence:CCGGGAATGTAGAACTCAGTCGATACTCGAGTATCGACTGAGTTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032816
CEP89 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 89kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1113s1c1
Sequence:CCGGGAAGAGGTAACGTTTCCGATTCTCGAGAATCGGAAACGTTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-427s1c1
Sequence:CCGGCTTCTTTGCCATCCTTTGAAACTCGAGTTTCAAAGGATGGCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-771s1c1
Sequence:CCGGGCACGTCAAAGATATACAGAACTCGAGTTCTGTATATCTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-753s1c1
Sequence:CCGGCCAGATATAACTGGTAGAGCACTCGAGTGCTCTACCAGTTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-1119s1c1
Sequence:CCGGGTAACGTTTCCGATTGTGAAACTCGAGTTTCACAATCGGAAACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032816.2-584s1c1
Sequence:CCGGGCCATTGTTACATGAGGTGAACTCGAGTTCACCTCATGTAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-978s1c1
Sequence:CCGGGCTGCACCTGAATTACTTTATCTCGAGATAAAGTAATTCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-116s1c1
Sequence:CCGGCAGGAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032816.2-1064s1c1
Sequence:CCGGGAATGTAGAACTCAGTCGATACTCGAGTATCGACTGAGTTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks