EMAIL THIS PAGE TO A FRIEND

CEP95

centrosomal protein 95kDa

Synonyms: CCDC45
UniProtKB ID: Q96GE4, Q96M81
Gene ID:
Mouse(320162) centrosomal protein 95
Rat(287766) centrosomal protein 95kDa
domestic guinea pig(100718843) centrosomal protein 95kDa
naked mole-rat(101706751) centrosomal protein 95kDa
sheep(101106443) centrosomal protein 95kDa
chicken(417419) centrosomal protein 95kDa
cow(506840) centrosomal protein 95kDa
Horse(100064141) centrosomal protein 95kDa
domestic cat(101099849) centrosomal protein 95kDa
dog(480471) centrosomal protein 95kDa
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001541 MISSION® esiRNA esiRNA targeting human CCDC45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138363 Rosetta Predictions human pricing
NM_001013862 Rosetta Predictions rat pricing
NM_177088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057969 predicted 2171
2 SASI_Hs02_00363462 predicted 1478
3 SASI_Hs01_00057970 predicted 1011
4 SASI_Hs02_00363463 predicted 578
5 SASI_Hs01_00057972 predicted 2035
6 SASI_Hs01_00057973 predicted 1488
7 SASI_Hs01_00057974 predicted 225
8 SASI_Hs01_00057975 predicted 1928
9 SASI_Hs01_00057976 predicted 1810
10 SASI_Hs01_00057977 predicted 2098
11 SASI_Hs01_00057971 predicted 2347
12 SASI_Hs01_00057978 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044267 predicted 1801
2 SASI_Rn01_00044268 predicted 646
3 SASI_Rn01_00044269 predicted 2319
4 SASI_Rn02_00201129 predicted 2399
5 SASI_Rn01_00044271 predicted 2162
6 SASI_Rn01_00044272 predicted 2209
7 SASI_Rn01_00044273 predicted 2621
8 SASI_Rn01_00044274 predicted 1304
9 SASI_Rn01_00044275 predicted 1887
10 SASI_Rn01_00044276 predicted 2058
11 SASI_Rn01_00044270 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026355 predicted 2316
2 SASI_Mm01_00026356 predicted 285
3 SASI_Mm01_00026357 predicted 452
4 SASI_Mm01_00026358 predicted 1400
5 SASI_Mm01_00026359 predicted 383
6 SASI_Mm01_00026360 predicted 1260
7 SASI_Mm01_00026361 predicted 994
8 SASI_Mm01_00026362 predicted 2368
9 SASI_Mm01_00026364 predicted 2208
10 SASI_Mm02_00347083 predicted 2031
11 SASI_Mm01_00026363 predicted 1623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138363
CEP95 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 95kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1523s1c1
Sequence:CCGGGAAAGGGAACTAAGAAGACATCTCGAGATGTCTTCTTAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-403s1c1
Sequence:CCGGCAGTGAAACATCTCATGAGAACTCGAGTTCTCATGAGATGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1766s1c1
Sequence:CCGGCTGGAGCAGTTTCCGTTTCTTCTCGAGAAGAAACGGAAACTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-759s1c1
Sequence:CCGGCCTTTGTTGAAGACACGGAAACTCGAGTTTCCGTGTCTTCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-87s1c1
Sequence:CCGGCCATTGCCAATAACCTTCTTTCTCGAGAAAGAAGGTTATTGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1323s21c1
Sequence:CCGGGTGATGGCATCGTGGAGTATGCTCGAGCATACTCCACGATGCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-989s21c1
Sequence:CCGGTTAATTTCCAAGTTGCCTAAACTCGAGTTTAGGCAACTTGGAAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-292s21c1
Sequence:CCGGGGTCAGCTTGTCTCACATAACCTCGAGGTTATGTGAGACAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-941s21c1
Sequence:CCGGACTGGAGAGCATACGGAATTTCTCGAGAAATTCCGTATGCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1222s21c1
Sequence:CCGGTGCTCTGGGTGATCGGATTAACTCGAGTTAATCCGATCACCCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-827s21c1
Sequence:CCGGATCCGAGCAGCTATTCCTTTACTCGAGTAAAGGAATAGCTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-2007s21c1
Sequence:CCGGGGTTGACCCAATCAAAGATAACTCGAGTTATCTTTGATTGGGTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138363
CEP95 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 95kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1523s1c1
Sequence:CCGGGAAAGGGAACTAAGAAGACATCTCGAGATGTCTTCTTAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-403s1c1
Sequence:CCGGCAGTGAAACATCTCATGAGAACTCGAGTTCTCATGAGATGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1766s1c1
Sequence:CCGGCTGGAGCAGTTTCCGTTTCTTCTCGAGAAGAAACGGAAACTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-759s1c1
Sequence:CCGGCCTTTGTTGAAGACACGGAAACTCGAGTTTCCGTGTCTTCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-87s1c1
Sequence:CCGGCCATTGCCAATAACCTTCTTTCTCGAGAAAGAAGGTTATTGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1323s21c1
Sequence:CCGGGTGATGGCATCGTGGAGTATGCTCGAGCATACTCCACGATGCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-989s21c1
Sequence:CCGGTTAATTTCCAAGTTGCCTAAACTCGAGTTTAGGCAACTTGGAAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-292s21c1
Sequence:CCGGGGTCAGCTTGTCTCACATAACCTCGAGGTTATGTGAGACAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-941s21c1
Sequence:CCGGACTGGAGAGCATACGGAATTTCTCGAGAAATTCCGTATGCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1222s21c1
Sequence:CCGGTGCTCTGGGTGATCGGATTAACTCGAGTTAATCCGATCACCCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-827s21c1
Sequence:CCGGATCCGAGCAGCTATTCCTTTACTCGAGTAAAGGAATAGCTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-2007s21c1
Sequence:CCGGGGTTGACCCAATCAAAGATAACTCGAGTTATCTTTGATTGGGTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138363
CEP95 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 95kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1523s1c1
Sequence:CCGGGAAAGGGAACTAAGAAGACATCTCGAGATGTCTTCTTAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-403s1c1
Sequence:CCGGCAGTGAAACATCTCATGAGAACTCGAGTTCTCATGAGATGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-1766s1c1
Sequence:CCGGCTGGAGCAGTTTCCGTTTCTTCTCGAGAAGAAACGGAAACTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-759s1c1
Sequence:CCGGCCTTTGTTGAAGACACGGAAACTCGAGTTTCCGTGTCTTCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138363.1-87s1c1
Sequence:CCGGCCATTGCCAATAACCTTCTTTCTCGAGAAAGAAGGTTATTGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1323s21c1
Sequence:CCGGGTGATGGCATCGTGGAGTATGCTCGAGCATACTCCACGATGCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-989s21c1
Sequence:CCGGTTAATTTCCAAGTTGCCTAAACTCGAGTTTAGGCAACTTGGAAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-292s21c1
Sequence:CCGGGGTCAGCTTGTCTCACATAACCTCGAGGTTATGTGAGACAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-941s21c1
Sequence:CCGGACTGGAGAGCATACGGAATTTCTCGAGAAATTCCGTATGCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-1222s21c1
Sequence:CCGGTGCTCTGGGTGATCGGATTAACTCGAGTTAATCCGATCACCCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-827s21c1
Sequence:CCGGATCCGAGCAGCTATTCCTTTACTCGAGTAAAGGAATAGCTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138363.1-2007s21c1
Sequence:CCGGGGTTGACCCAATCAAAGATAACTCGAGTTATCTTTGATTGGGTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177088
VALIDATED
CEP95 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 95kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-395s21c1
Sequence:CCGGTTGATGGATTGCTGGATTATCCTCGAGGATAATCCAGCAATCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-1577s21c1
Sequence:CCGGACGTTGGACTTCGAGGGATAACTCGAGTTATCCCTCGAAGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2278s21c1
Sequence:CCGGTCGATGGAGAACCACTATAAGCTCGAGCTTATAGTGGTTCTCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2074s21c1
Sequence:CCGGAGTGTTCGTGCCCGGAAATATCTCGAGATATTTCCGGGCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-271s21c1
Sequence:CCGGCACAATGTCCAAGCGGTAATTCTCGAGAATTACCGCTTGGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177088
VALIDATED
CEP95 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 95kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-395s21c1
Sequence:CCGGTTGATGGATTGCTGGATTATCCTCGAGGATAATCCAGCAATCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-1577s21c1
Sequence:CCGGACGTTGGACTTCGAGGGATAACTCGAGTTATCCCTCGAAGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2278s21c1
Sequence:CCGGTCGATGGAGAACCACTATAAGCTCGAGCTTATAGTGGTTCTCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2074s21c1
Sequence:CCGGAGTGTTCGTGCCCGGAAATATCTCGAGATATTTCCGGGCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-271s21c1
Sequence:CCGGCACAATGTCCAAGCGGTAATTCTCGAGAATTACCGCTTGGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177088
VALIDATED
CEP95 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 95kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-395s21c1
Sequence:CCGGTTGATGGATTGCTGGATTATCCTCGAGGATAATCCAGCAATCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-1577s21c1
Sequence:CCGGACGTTGGACTTCGAGGGATAACTCGAGTTATCCCTCGAAGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2278s21c1
Sequence:CCGGTCGATGGAGAACCACTATAAGCTCGAGCTTATAGTGGTTCTCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-2074s21c1
Sequence:CCGGAGTGTTCGTGCCCGGAAATATCTCGAGATATTTCCGGGCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177088.2-271s21c1
Sequence:CCGGCACAATGTCCAAGCGGTAATTCTCGAGAATTACCGCTTGGACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks