EMAIL THIS PAGE TO A FRIEND

CEP97

centrosomal protein 97kDa

64 Gene Product Result for
Synonyms: 2810403B08Rik LRRIQ2
UniProtKB ID: Q8IW35, B5MDY8, Q8NA71, Q9H5T9
Gene ID:
Mouse(74201) centrosomal protein 97
Rat(304007) centrosomal protein 97
Zebrafish(386640) centrosomal protein 97
chicken(418402) centrosomal protein 97kDa
fruit fly(33610) CG3980 gene product from transcript CG3980-RB
domestic cat(101095602) centrosomal protein 97kDa
cow(540395) centrosomal protein 97kDa
Horse(100072170) centrosomal protein 97kDa
dog(608540) centrosomal protein 97kDa
sheep(101112438) centrosomal protein 97kDa
Domestic Rabbit(100356991) centrosomal protein 97kDa
naked mole-rat(101722360) centrosomal protein 97kDa
domestic guinea pig(100715232) centrosomal protein 97kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024548 Rosetta Predictions human pricing
NM_001107096 Rosetta Predictions rat pricing
NM_028815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107381 predicted 418
2 SASI_Hs01_00107382 predicted 1504
3 SASI_Hs01_00107383 predicted 703
4 SASI_Hs01_00107385 predicted 2005
5 SASI_Hs01_00107386 predicted 1387
6 SASI_Hs01_00107387 predicted 1852
7 SASI_Hs01_00107388 predicted 1792
8 SASI_Hs01_00107389 predicted 1993
9 SASI_Hs02_00356850 predicted 542
10 SASI_Hs02_00356851 predicted 398
11 SASI_Hs01_00107380 predicted 2386
12 SASI_Hs01_00107384 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225456 predicted 472
2 SASI_Rn02_00225457 predicted 607
3 SASI_Rn02_00225458 predicted 1320
4 SASI_Rn02_00225459 predicted 224
5 SASI_Rn02_00225460 predicted 1839
6 SASI_Rn02_00225461 predicted 380
7 SASI_Rn02_00225462 predicted 790
8 SASI_Rn02_00225463 predicted 699
9 SASI_Rn02_00225464 predicted 1423
10 SASI_Rn02_00225465 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194025 predicted 300
2 SASI_Mm01_00194026 predicted 1315
3 SASI_Mm01_00194027 predicted 2518
4 SASI_Mm01_00194028 predicted 728
5 SASI_Mm01_00194029 predicted 461
6 SASI_Mm01_00194030 predicted 367
7 SASI_Mm01_00194031 predicted 1433
8 SASI_Mm01_00194032 predicted 435
9 SASI_Mm01_00194034 predicted 1521
10 SASI_Mm02_00334432 predicted 229
11 SASI_Mm01_00194033 predicted 2456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024548
VALIDATED
CEP97 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 97kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-262s21c1
Sequence:CCGGCTGACGTTGCTTCGTGTATTACTCGAGTAATACACGAAGCAACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-3582s21c1
Sequence:CCGGGTAATACTACTGGTCGAATATCTCGAGATATTCGACCAGTAGTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-210s21c1
Sequence:CCGGACAGTTATCAGTAGCTAATAACTCGAGTTATTAGCTACTGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-2011s21c1
Sequence:CCGGCCATCGAAACATCCATTATTTCTCGAGAAATAATGGATGTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-401s21c1
Sequence:CCGGCTCTACAGCATCTCGATTTATCTCGAGATAAATCGAGATGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-1769s1c1
Sequence:CCGGCCAAAGATGTGCGTTACGAAACTCGAGTTTCGTAACGCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-133s1c1
Sequence:CCGGGCTGATATTCACACTTTGATTCTCGAGAATCAAAGTGTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024548
VALIDATED
CEP97 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 97kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-262s21c1
Sequence:CCGGCTGACGTTGCTTCGTGTATTACTCGAGTAATACACGAAGCAACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-3582s21c1
Sequence:CCGGGTAATACTACTGGTCGAATATCTCGAGATATTCGACCAGTAGTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-210s21c1
Sequence:CCGGACAGTTATCAGTAGCTAATAACTCGAGTTATTAGCTACTGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-2011s21c1
Sequence:CCGGCCATCGAAACATCCATTATTTCTCGAGAAATAATGGATGTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-401s21c1
Sequence:CCGGCTCTACAGCATCTCGATTTATCTCGAGATAAATCGAGATGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-1769s1c1
Sequence:CCGGCCAAAGATGTGCGTTACGAAACTCGAGTTTCGTAACGCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-133s1c1
Sequence:CCGGGCTGATATTCACACTTTGATTCTCGAGAATCAAAGTGTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024548
VALIDATED
CEP97 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 97kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-262s21c1
Sequence:CCGGCTGACGTTGCTTCGTGTATTACTCGAGTAATACACGAAGCAACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-3582s21c1
Sequence:CCGGGTAATACTACTGGTCGAATATCTCGAGATATTCGACCAGTAGTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-210s21c1
Sequence:CCGGACAGTTATCAGTAGCTAATAACTCGAGTTATTAGCTACTGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-2011s21c1
Sequence:CCGGCCATCGAAACATCCATTATTTCTCGAGAAATAATGGATGTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024548.2-401s21c1
Sequence:CCGGCTCTACAGCATCTCGATTTATCTCGAGATAAATCGAGATGCTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-1769s1c1
Sequence:CCGGCCAAAGATGTGCGTTACGAAACTCGAGTTTCGTAACGCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024548.2-133s1c1
Sequence:CCGGGCTGATATTCACACTTTGATTCTCGAGAATCAAAGTGTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028815
CEP97 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 97kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-2522s1c1
Sequence:CCGGGCCAGAGAATTGTCAGTTAAACTCGAGTTTAACTGACAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-128s1c1
Sequence:CCGGGCAGAAATTAGGTGCCAACTTCTCGAGAAGTTGGCACCTAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028815.3-3046s1c1
Sequence:CCGGCCACCCTTTGTGTTAAGGAAACTCGAGTTTCCTTAACACAAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-371s1c1
Sequence:CCGGGCTGAATTTAGCGGGCAATAACTCGAGTTATTGCCCGCTAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028815
CEP97 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 97kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-2522s1c1
Sequence:CCGGGCCAGAGAATTGTCAGTTAAACTCGAGTTTAACTGACAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-128s1c1
Sequence:CCGGGCAGAAATTAGGTGCCAACTTCTCGAGAAGTTGGCACCTAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028815.3-3046s1c1
Sequence:CCGGCCACCCTTTGTGTTAAGGAAACTCGAGTTTCCTTAACACAAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-371s1c1
Sequence:CCGGGCTGAATTTAGCGGGCAATAACTCGAGTTATTGCCCGCTAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028815
CEP97 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 97kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-2522s1c1
Sequence:CCGGGCCAGAGAATTGTCAGTTAAACTCGAGTTTAACTGACAATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-128s1c1
Sequence:CCGGGCAGAAATTAGGTGCCAACTTCTCGAGAAGTTGGCACCTAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028815.3-3046s1c1
Sequence:CCGGCCACCCTTTGTGTTAAGGAAACTCGAGTTTCCTTAACACAAAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028815.3-371s1c1
Sequence:CCGGGCTGAATTTAGCGGGCAATAACTCGAGTTATTGCCCGCTAAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks