EMAIL THIS PAGE TO A FRIEND

CEPT1

choline/ethanolamine phosphotransferase 1

99 Gene Product Result for
UniProtKB ID: Q9Y6K0, Q69YJ9, Q9P0Y8
Gene ID:
Human(10390) Summary: Cholinephosphotransferase catalyses the final step in the synthesis of phosphatidylcholine by the transfer of phosphocholine from CDP-choline to diacylglycerol. The synthesis of phosphatidylethanolamine by ethanolaminephosphotransferase occurs using an analogous reaction. This gene codes for a choline/ethanolaminephosphotransferase. The protein can synthesize either choline- or ethanolamine- containing phospholipids. Two alternatively spliced transcripts encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Mouse(99712) choline/ethanolaminephosphotransferase 1
Rat(310773) choline/ethanolamine phosphotransferase 1
chicken(421152) choline/ethanolamine phosphotransferase 1
cow(504650) choline/ethanolamine phosphotransferase 1
Horse(100062845) choline/ethanolamine phosphotransferase 1
domestic cat(101093451) choline/ethanolamine phosphotransferase 1
dog(612948) choline/ethanolamine phosphotransferase 1
domestic guinea pig(100736166) choline/ethanolamine phosphotransferase 1
naked mole-rat(101721378) choline/ethanolamine phosphotransferase 1
sheep(101112775) choline/ethanolamine phosphotransferase 1
Domestic Rabbit(100353363) choline/ethanolamine phosphotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006090 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007794 Rosetta Predictions human pricing
NM_006090 Rosetta Predictions human pricing
NM_001007699 Rosetta Predictions rat pricing
NM_133869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205501 predicted 1069
2 SASI_Hs01_00205502 predicted 884
3 SASI_Hs01_00205503 predicted 820
4 SASI_Hs01_00205504 predicted 470
5 SASI_Hs01_00205505 predicted 1443
6 SASI_Hs01_00205507 predicted 635
7 SASI_Hs01_00205509 predicted 1099
8 SASI_Hs01_00205510 predicted 1030
9 SASI_Hs02_00305361 predicted 671
10 SASI_Hs02_00305362 predicted 1322
11 SASI_Hs01_00205506 predicted 1054
12 SASI_Hs01_00205508 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090247 predicted 1037
2 SASI_Hs01_00090248 predicted 844
3 SASI_Hs01_00090249 predicted 786
4 SASI_Hs01_00090250 predicted 429
5 SASI_Hs01_00090251 predicted 1406
6 SASI_Hs01_00090253 predicted 596
7 SASI_Hs01_00090255 predicted 1054
8 SASI_Hs01_00090256 predicted 992
9 SASI_Hs02_00340869 predicted 632
10 SASI_Hs02_00340870 predicted 1277
11 SASI_Hs01_00090252 predicted 1024
12 SASI_Hs01_00090254 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063851 predicted 1552
2 SASI_Rn02_00198858 predicted 1095
3 SASI_Rn01_00063852 predicted 902
4 SASI_Rn01_00063853 predicted 1125
5 SASI_Rn01_00063854 predicted 1056
6 SASI_Rn01_00063855 predicted 1318
7 SASI_Rn01_00063856 predicted 349
8 SASI_Rn01_00063858 predicted 1458
9 SASI_Rn01_00063859 predicted 892
10 SASI_Rn01_00063860 predicted 1412
11 SASI_Rn01_00063857 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338927 predicted 1105
2 SASI_Mm01_00180315 predicted 832
3 SASI_Mm01_00180316 predicted 1476
4 SASI_Mm01_00180317 predicted 866
5 SASI_Mm01_00180318 predicted 776
6 SASI_Mm01_00180319 predicted 225
7 SASI_Mm01_00180320 predicted 683
8 SASI_Mm01_00180321 predicted 1350
9 SASI_Mm01_00180322 predicted 1389
10 SASI_Mm02_00338928 predicted 746
11 SASI_Mm01_00180323 predicted 831
12 SASI_Mm01_00180324 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133869
VALIDATED
CEPT1 MISSION shRNA Bacterial Glycerol Stock
choline/ethanolamine phosphotransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-424s1c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-411s1c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-672s1c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1056s1c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1587s1c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133869.3-1586s21c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-423s21c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-1055s21c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-410s21c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-671s21c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133869
VALIDATED
CEPT1 MISSION shRNA shRNA Plasmid DNA
choline/ethanolamine phosphotransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-424s1c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-411s1c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-672s1c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1056s1c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1587s1c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133869.3-1586s21c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-423s21c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-1055s21c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-410s21c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-671s21c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133869
VALIDATED
CEPT1 MISSION shRNA Lentiviral Transduction Particles
choline/ethanolamine phosphotransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-424s1c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-411s1c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-672s1c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1056s1c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133869.2-1587s1c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133869.3-1586s21c1
Sequence:CCGGCCCATCCTATAAACTGAATATCTCGAGATATTCAGTTTATAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-423s21c1
Sequence:CCGGCCATCATTGGACTATCAATAACTCGAGTTATTGATAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-1055s21c1
Sequence:CCGGGCTGTTATGATCTACAAGAAACTCGAGTTTCTTGTAGATCATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-410s21c1
Sequence:CCGGCCAAATCTCATCACCATCATTCTCGAGAATGATGGTGATGAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133869.3-671s21c1
Sequence:CCGGGCAGTACAACTTGGGACAAATCTCGAGATTTGTCCCAAGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006090
VALIDATED
CEPT1 MISSION shRNA Bacterial Glycerol Stock
choline/ethanolamine phosphotransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-387s1c1
Sequence:CCGGCCATCATTGGACTGTCAATAACTCGAGTTATTGACAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-245s1c1
Sequence:CCGGCCATTGTCAAGACACCAACTACTCGAGTAGTTGGTGTCTTGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-906s1c1
Sequence:CCGGGTACAAATTACTTCCGTGTAACTCGAGTTACACGGAAGTAATTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-708s1c1
Sequence:CCGGCGCACTGGCAAACGTATGTTTCTCGAGAAACATACGTTTGCCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-314s1c1
Sequence:CCGGGAGCCCTTAATGCAAGGGTATCTCGAGATACCCTTGCATTAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-1553s21c1
Sequence:CCGGTGGTAACACGCCCTAACTATCCTCGAGGATAGTTAGGGCGTGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-930s21c1
Sequence:CCGGACTGTAGCAGGGACCATATTTCTCGAGAAATATGGTCCCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-1400s21c1
Sequence:CCGGAGCTCATTCTAATCATCATTACTCGAGTAATGATGATTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-437s21c1
Sequence:CCGGCATCATTGGACTGTCAATAAACTCGAGTTTATTGACAGTCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-509s21c1
Sequence:CCGGGGCACCTCTGTGGGCATATATCTCGAGATATATGCCCACAGAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006090
VALIDATED
CEPT1 MISSION shRNA shRNA Plasmid DNA
choline/ethanolamine phosphotransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-387s1c1
Sequence:CCGGCCATCATTGGACTGTCAATAACTCGAGTTATTGACAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-245s1c1
Sequence:CCGGCCATTGTCAAGACACCAACTACTCGAGTAGTTGGTGTCTTGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-906s1c1
Sequence:CCGGGTACAAATTACTTCCGTGTAACTCGAGTTACACGGAAGTAATTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-708s1c1
Sequence:CCGGCGCACTGGCAAACGTATGTTTCTCGAGAAACATACGTTTGCCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-314s1c1
Sequence:CCGGGAGCCCTTAATGCAAGGGTATCTCGAGATACCCTTGCATTAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-1553s21c1
Sequence:CCGGTGGTAACACGCCCTAACTATCCTCGAGGATAGTTAGGGCGTGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-930s21c1
Sequence:CCGGACTGTAGCAGGGACCATATTTCTCGAGAAATATGGTCCCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-1400s21c1
Sequence:CCGGAGCTCATTCTAATCATCATTACTCGAGTAATGATGATTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-437s21c1
Sequence:CCGGCATCATTGGACTGTCAATAAACTCGAGTTTATTGACAGTCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-509s21c1
Sequence:CCGGGGCACCTCTGTGGGCATATATCTCGAGATATATGCCCACAGAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006090
VALIDATED
CEPT1 MISSION shRNA Lentiviral Transduction Particles
choline/ethanolamine phosphotransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-387s1c1
Sequence:CCGGCCATCATTGGACTGTCAATAACTCGAGTTATTGACAGTCCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-245s1c1
Sequence:CCGGCCATTGTCAAGACACCAACTACTCGAGTAGTTGGTGTCTTGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-906s1c1
Sequence:CCGGGTACAAATTACTTCCGTGTAACTCGAGTTACACGGAAGTAATTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-708s1c1
Sequence:CCGGCGCACTGGCAAACGTATGTTTCTCGAGAAACATACGTTTGCCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006090.2-314s1c1
Sequence:CCGGGAGCCCTTAATGCAAGGGTATCTCGAGATACCCTTGCATTAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-1553s21c1
Sequence:CCGGTGGTAACACGCCCTAACTATCCTCGAGGATAGTTAGGGCGTGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-930s21c1
Sequence:CCGGACTGTAGCAGGGACCATATTTCTCGAGAAATATGGTCCCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-1400s21c1
Sequence:CCGGAGCTCATTCTAATCATCATTACTCGAGTAATGATGATTAGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006090.3-437s21c1
Sequence:CCGGCATCATTGGACTGTCAATAAACTCGAGTTTATTGACAGTCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006090.3-509s21c1
Sequence:CCGGGGCACCTCTGTGGGCATATATCTCGAGATATATGCCCACAGAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks