EMAIL THIS PAGE TO A FRIEND

CER1

cerberus 1, DAN family BMP antagonist

69 Gene Product Result for
Synonyms: DAND4
UniProtKB ID: O95813, Q6ISJ1, Q6ISJ6, Q6ISQ2, Q6ISS1
Gene ID:
Human(9350) Summary: This gene encodes a cytokine member of the cysteine knot superfamily, characterized by nine conserved cysteines and a cysteine knot region. The cerberus-related cytokines, together with Dan and DRM/Gremlin, represent a group of bone morphogenetic protein (BMP) antagonists that can bind directly to BMPs and inhibit their activity. [provided by RefSeq, Jul 2008]
Mouse(12622) cerberus 1 homolog (Xenopus laevis)
Rat(500485) cerberus 1, DAN family BMP antagonist
Thale Cress(837602) protein ECERIFERUM 1
dog(611037) cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
chicken(395623) cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
domestic cat(101080489) cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
cow(508019) cerberus 1, DAN family BMP antagonist
sheep(101122006) cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)
naked mole-rat(101724244) cerberus 1, DAN family BMP antagonist
domestic guinea pig(100715807) cerberus 1, DAN family BMP antagonist
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005454 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005454 Rosetta Predictions human pricing
NM_001115031 Rosetta Predictions rat pricing
XM_575851 Rosetta Predictions rat pricing
XR_008686 Rosetta Predictions rat pricing
NM_009887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111744 predicted 329
2 SASI_Hs01_00111745 predicted 800
3 SASI_Hs01_00111746 predicted 497
4 SASI_Hs01_00111747 predicted 283
5 SASI_Hs01_00111748 predicted 694
6 SASI_Hs01_00111749 predicted 427
7 SASI_Hs01_00111750 predicted 296
8 SASI_Hs01_00111751 predicted 605
9 SASI_Hs01_00111752 predicted 198
10 SASI_Hs01_00111753 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252483 predicted 304
2 SASI_Rn02_00252484 predicted 508
3 SASI_Rn02_00252485 predicted 395
4 SASI_Rn02_00252486 predicted 1335
5 SASI_Rn02_00252487 predicted 312
6 SASI_Rn02_00252488 predicted 507
7 SASI_Rn02_00252489 predicted 609
8 SASI_Rn02_00252490 predicted 1248
9 SASI_Rn02_00252491 predicted 283
10 SASI_Rn02_00252492 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149077 predicted 263
2 SASI_Rn01_00149078 predicted 463
3 SASI_Rn01_00149079 predicted 350
4 SASI_Rn01_00149080 predicted 257
5 SASI_Rn01_00149081 predicted 464
6 SASI_Rn01_00149082 predicted 560
7 SASI_Rn01_00149083 predicted 297
8 SASI_Rn01_00149084 predicted 233
9 SASI_Rn01_00149085 predicted 401
10 SASI_Rn01_00149086 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00197150 predicted 259
2 SASI_Rn01_00197151 predicted 459
3 SASI_Rn01_00197152 predicted 349
4 SASI_Rn01_00197153 predicted 266
5 SASI_Rn01_00197154 predicted 463
6 SASI_Rn01_00197155 predicted 566
7 SASI_Rn01_00197156 predicted 297
8 SASI_Rn01_00197157 predicted 241
9 SASI_Rn01_00197158 predicted 398
10 SASI_Rn01_00197159 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163405 predicted 745
2 SASI_Mm01_00163406 predicted 414
3 SASI_Mm01_00163407 predicted 322
4 SASI_Mm01_00163408 predicted 505
5 SASI_Mm01_00163409 predicted 573
6 SASI_Mm02_00317376 predicted 754
7 SASI_Mm01_00163410 predicted 555
8 SASI_Mm01_00163411 predicted 462
9 SASI_Mm01_00163412 predicted 209
10 SASI_Mm01_00163413 predicted 360
11 SASI_Mm01_00163414 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009887
CER1 MISSION shRNA Bacterial Glycerol Stock
cerberus 1, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-704s21c1
Sequence:CCGGCAAATTCACCACCGTGCACTTCTCGAGAAGTGCACGGTGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-579s21c1
Sequence:CCGGATTGCCCATGAAGACTGTCAACTCGAGTTGACAGTCTTCATGGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009887.1-1017s1c1
Sequence:CCGGCCCTCTCTCTTCTCTCTATTTCTCGAGAAATAGAGAGAAGAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-232s1c1
Sequence:CCGGAGAAGACAAGCCGGATCTGTTCTCGAGAACAGATCCGGCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-371s1c1
Sequence:CCGGCCAAGGGATGTGGAAAGCGATCTCGAGATCGCTTTCCACATCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-484s1c1
Sequence:CCGGGCATCGGTTCATGTTCAGAAACTCGAGTTTCTGAACATGAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-640s1c1
Sequence:CCGGCTTTGGCAAATGCAGTTCCATCTCGAGATGGAACTGCATTTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009887
CER1 MISSION shRNA shRNA Plasmid DNA
cerberus 1, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-704s21c1
Sequence:CCGGCAAATTCACCACCGTGCACTTCTCGAGAAGTGCACGGTGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-579s21c1
Sequence:CCGGATTGCCCATGAAGACTGTCAACTCGAGTTGACAGTCTTCATGGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009887.1-1017s1c1
Sequence:CCGGCCCTCTCTCTTCTCTCTATTTCTCGAGAAATAGAGAGAAGAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-232s1c1
Sequence:CCGGAGAAGACAAGCCGGATCTGTTCTCGAGAACAGATCCGGCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-371s1c1
Sequence:CCGGCCAAGGGATGTGGAAAGCGATCTCGAGATCGCTTTCCACATCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-484s1c1
Sequence:CCGGGCATCGGTTCATGTTCAGAAACTCGAGTTTCTGAACATGAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-640s1c1
Sequence:CCGGCTTTGGCAAATGCAGTTCCATCTCGAGATGGAACTGCATTTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009887
CER1 MISSION shRNA Lentiviral Transduction Particles
cerberus 1, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-704s21c1
Sequence:CCGGCAAATTCACCACCGTGCACTTCTCGAGAAGTGCACGGTGGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009887.2-579s21c1
Sequence:CCGGATTGCCCATGAAGACTGTCAACTCGAGTTGACAGTCTTCATGGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009887.1-1017s1c1
Sequence:CCGGCCCTCTCTCTTCTCTCTATTTCTCGAGAAATAGAGAGAAGAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-232s1c1
Sequence:CCGGAGAAGACAAGCCGGATCTGTTCTCGAGAACAGATCCGGCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-371s1c1
Sequence:CCGGCCAAGGGATGTGGAAAGCGATCTCGAGATCGCTTTCCACATCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-484s1c1
Sequence:CCGGGCATCGGTTCATGTTCAGAAACTCGAGTTTCTGAACATGAACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009887.1-640s1c1
Sequence:CCGGCTTTGGCAAATGCAGTTCCATCTCGAGATGGAACTGCATTTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005454
CER1 MISSION shRNA Bacterial Glycerol Stock
cerberus 1, DAN family BMP antagonist
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-269s1c1
Sequence:CCGGCTGAGAGAGAAATGCATCCATCTCGAGATGGATGCATTTCTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-229s1c1
Sequence:CCGGGAGAAGATGCTGTCCAGATTTCTCGAGAAATCTGGACAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-546s1c1
Sequence:CCGGGAACAACCTTTGCTTTGGGAACTCGAGTTCCCAAAGCAAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-564s1c1
Sequence:CCGGGAAATGCGGGTCTGTTCATTTCTCGAGAAATGAACAGACCCGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-106s1c1
Sequence:CCGGCCAAGGAATCAAAGAGAGCTTCTCGAGAAGCTCTCTTTGATTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-390s1c1
Sequence:CCGGCAAGAAATTCTGGCACCACTTCTCGAGAAGTGGTGCCAGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-636s1c1
Sequence:CCGGCAAGTTCACCACGATGCACTTCTCGAGAAGTGCATCGTGGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-339s1c1
Sequence:CCGGCCAGCCGATAGATGGAATGAACTCGAGTTCATTCCATCTATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-461s1c1
Sequence:CCGGGCCATGAAGTACATTGGGAGACTCGAGTCTCCCAATGTACTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-227s1c1
Sequence:CCGGGAGAGAAGATGCTGTCCAGATCTCGAGATCTGGACAGCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005454
CER1 MISSION shRNA shRNA Plasmid DNA
cerberus 1, DAN family BMP antagonist
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-269s1c1
Sequence:CCGGCTGAGAGAGAAATGCATCCATCTCGAGATGGATGCATTTCTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-229s1c1
Sequence:CCGGGAGAAGATGCTGTCCAGATTTCTCGAGAAATCTGGACAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-546s1c1
Sequence:CCGGGAACAACCTTTGCTTTGGGAACTCGAGTTCCCAAAGCAAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-564s1c1
Sequence:CCGGGAAATGCGGGTCTGTTCATTTCTCGAGAAATGAACAGACCCGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-106s1c1
Sequence:CCGGCCAAGGAATCAAAGAGAGCTTCTCGAGAAGCTCTCTTTGATTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-390s1c1
Sequence:CCGGCAAGAAATTCTGGCACCACTTCTCGAGAAGTGGTGCCAGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-636s1c1
Sequence:CCGGCAAGTTCACCACGATGCACTTCTCGAGAAGTGCATCGTGGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-339s1c1
Sequence:CCGGCCAGCCGATAGATGGAATGAACTCGAGTTCATTCCATCTATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-461s1c1
Sequence:CCGGGCCATGAAGTACATTGGGAGACTCGAGTCTCCCAATGTACTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-227s1c1
Sequence:CCGGGAGAGAAGATGCTGTCCAGATCTCGAGATCTGGACAGCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005454
CER1 MISSION shRNA Lentiviral Transduction Particles
cerberus 1, DAN family BMP antagonist
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-269s1c1
Sequence:CCGGCTGAGAGAGAAATGCATCCATCTCGAGATGGATGCATTTCTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-229s1c1
Sequence:CCGGGAGAAGATGCTGTCCAGATTTCTCGAGAAATCTGGACAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-546s1c1
Sequence:CCGGGAACAACCTTTGCTTTGGGAACTCGAGTTCCCAAAGCAAAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-564s1c1
Sequence:CCGGGAAATGCGGGTCTGTTCATTTCTCGAGAAATGAACAGACCCGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-106s1c1
Sequence:CCGGCCAAGGAATCAAAGAGAGCTTCTCGAGAAGCTCTCTTTGATTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-390s1c1
Sequence:CCGGCAAGAAATTCTGGCACCACTTCTCGAGAAGTGGTGCCAGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-636s1c1
Sequence:CCGGCAAGTTCACCACGATGCACTTCTCGAGAAGTGCATCGTGGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-339s1c1
Sequence:CCGGCCAGCCGATAGATGGAATGAACTCGAGTTCATTCCATCTATCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005454.1-461s1c1
Sequence:CCGGGCCATGAAGTACATTGGGAGACTCGAGTCTCCCAATGTACTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005454.1-227s1c1
Sequence:CCGGGAGAGAAGATGCTGTCCAGATCTCGAGATCTGGACAGCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks