EMAIL THIS PAGE TO A FRIEND

CERCAM

cerebral endothelial cell adhesion molecule

95 Gene Product Result for
Synonyms: CEECAM1 GLT25D3
Gene ID:
Mouse(99151) cerebral endothelial cell adhesion molecule
Rat(296616) cerebral endothelial cell adhesion molecule
Zebrafish(558337) cerebral endothelial cell adhesion molecule
dog(609012) cerebral endothelial cell adhesion molecule
cow(516122) cerebral endothelial cell adhesion molecule
domestic cat(101093309) cerebral endothelial cell adhesion molecule
chicken(427768) cerebral endothelial cell adhesion molecule
domestic guinea pig(100713749) cerebral endothelial cell adhesion molecule
naked mole-rat(101725150) cerebral endothelial cell adhesion molecule
sheep(101107949) cerebral endothelial cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016174 Rosetta Predictions human pricing
NM_001011962 Rosetta Predictions rat pricing
XM_575103 Rosetta Predictions rat pricing
NM_207298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200146 predicted 1814
2 SASI_Hs01_00200147 predicted 1212
3 SASI_Hs01_00200148 predicted 377
4 SASI_Hs01_00200149 predicted 826
5 SASI_Hs01_00200150 predicted 2011
6 SASI_Hs02_00348987 predicted 1827
7 SASI_Hs01_00200151 predicted 470
8 SASI_Hs01_00200152 predicted 888
9 SASI_Hs01_00200154 predicted 992
10 SASI_Hs01_00200155 predicted 755
11 SASI_Hs01_00200153 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065430 predicted 610
2 SASI_Rn01_00065431 predicted 755
3 SASI_Rn01_00065432 predicted 1583
4 SASI_Rn01_00065433 predicted 698
5 SASI_Rn01_00065434 predicted 879
6 SASI_Rn02_00199982 predicted 1705
7 SASI_Rn01_00065435 predicted 652
8 SASI_Rn01_00065436 predicted 742
9 SASI_Rn01_00065437 predicted 971
10 SASI_Rn01_00065438 predicted 1488
11 SASI_Rn01_00065439 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171857 predicted 617
2 SASI_Rn01_00171858 predicted 758
3 SASI_Rn01_00171859 predicted 326
4 SASI_Rn01_00171860 predicted 311
5 SASI_Rn01_00171861 predicted 1595
6 SASI_Rn01_00171862 predicted 700
7 SASI_Rn01_00171863 predicted 890
8 SASI_Rn01_00171864 predicted 654
9 SASI_Rn01_00171865 predicted 740
10 SASI_Rn01_00171866 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352043 predicted 495
2 SASI_Mm02_00352044 predicted 609
3 SASI_Mm02_00352045 predicted 1266
4 SASI_Mm02_00352046 predicted 464
5 SASI_Mm02_00352047 predicted 1113
6 SASI_Mm02_00352048 predicted 551
7 SASI_Mm02_00352049 predicted 469
8 SASI_Mm02_00352050 predicted 884
9 SASI_Mm02_00352051 predicted 1065
10 SASI_Mm02_00352052 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016174
VALIDATED
CERCAM MISSION shRNA Bacterial Glycerol Stock
cerebral endothelial cell adhesion molecule
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1967s1c1
Sequence:CCGGCCTGTCTTTCATCGGGAGAAACTCGAGTTTCTCCCGATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-904s1c1
Sequence:CCGGCCACCTGATCTTAGAAGCACTCTCGAGAGTGCTTCTAAGATCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-466s1c1
Sequence:CCGGGTTTGCAGACACAGACAACATCTCGAGATGTTGTCTGTGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-905s1c1
Sequence:CCGGCACCTGATCTTAGAAGCACTACTCGAGTAGTGCTTCTAAGATCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-475s1c1
Sequence:CCGGCACAGACAACATTCTGACCAACTCGAGTTGGTCAGAATGTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-1222s1c1
Sequence:CCGGCCATTACTCCATCTGGGAAGACTCGAGTCTTCCCAGATGGAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1989s1c1
Sequence:CCGGCACTCAGAGATGGATCCCATTCTCGAGAATGGGATCCATCTCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-988s1c1
Sequence:CCGGGATAGGGTTTGACGAGGTCTTCTCGAGAAGACCTCGTCAAACCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-382s1c1
Sequence:CCGGGACCAAAGAAAGGCACCAGTTCTCGAGAACTGGTGCCTTTCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-2010s1c1
Sequence:CCGGCCCTAAAGGTCTCACAGCAAACTCGAGTTTGCTGTGAGACCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-832s1c1
Sequence:CCGGGCACCGTTATGGGTACATGAACTCGAGTTCATGTACCCATAACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016174
VALIDATED
CERCAM MISSION shRNA shRNA Plasmid DNA
cerebral endothelial cell adhesion molecule
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1967s1c1
Sequence:CCGGCCTGTCTTTCATCGGGAGAAACTCGAGTTTCTCCCGATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-904s1c1
Sequence:CCGGCCACCTGATCTTAGAAGCACTCTCGAGAGTGCTTCTAAGATCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-466s1c1
Sequence:CCGGGTTTGCAGACACAGACAACATCTCGAGATGTTGTCTGTGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-905s1c1
Sequence:CCGGCACCTGATCTTAGAAGCACTACTCGAGTAGTGCTTCTAAGATCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-475s1c1
Sequence:CCGGCACAGACAACATTCTGACCAACTCGAGTTGGTCAGAATGTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-1222s1c1
Sequence:CCGGCCATTACTCCATCTGGGAAGACTCGAGTCTTCCCAGATGGAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1989s1c1
Sequence:CCGGCACTCAGAGATGGATCCCATTCTCGAGAATGGGATCCATCTCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-988s1c1
Sequence:CCGGGATAGGGTTTGACGAGGTCTTCTCGAGAAGACCTCGTCAAACCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-382s1c1
Sequence:CCGGGACCAAAGAAAGGCACCAGTTCTCGAGAACTGGTGCCTTTCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-2010s1c1
Sequence:CCGGCCCTAAAGGTCTCACAGCAAACTCGAGTTTGCTGTGAGACCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-832s1c1
Sequence:CCGGGCACCGTTATGGGTACATGAACTCGAGTTCATGTACCCATAACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016174
VALIDATED
CERCAM MISSION shRNA Lentiviral Transduction Particles
cerebral endothelial cell adhesion molecule
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1967s1c1
Sequence:CCGGCCTGTCTTTCATCGGGAGAAACTCGAGTTTCTCCCGATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-904s1c1
Sequence:CCGGCCACCTGATCTTAGAAGCACTCTCGAGAGTGCTTCTAAGATCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-466s1c1
Sequence:CCGGGTTTGCAGACACAGACAACATCTCGAGATGTTGTCTGTGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-905s1c1
Sequence:CCGGCACCTGATCTTAGAAGCACTACTCGAGTAGTGCTTCTAAGATCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-475s1c1
Sequence:CCGGCACAGACAACATTCTGACCAACTCGAGTTGGTCAGAATGTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-1222s1c1
Sequence:CCGGCCATTACTCCATCTGGGAAGACTCGAGTCTTCCCAGATGGAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-1989s1c1
Sequence:CCGGCACTCAGAGATGGATCCCATTCTCGAGAATGGGATCCATCTCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016174.3-988s1c1
Sequence:CCGGGATAGGGTTTGACGAGGTCTTCTCGAGAAGACCTCGTCAAACCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-382s1c1
Sequence:CCGGGACCAAAGAAAGGCACCAGTTCTCGAGAACTGGTGCCTTTCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-2010s1c1
Sequence:CCGGCCCTAAAGGTCTCACAGCAAACTCGAGTTTGCTGTGAGACCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016174.3-832s1c1
Sequence:CCGGGCACCGTTATGGGTACATGAACTCGAGTTCATGTACCCATAACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130094
CERCAM MISSION shRNA Bacterial Glycerol Stock
cerebral endothelial cell adhesion molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130094.4-2121s1c1
Sequence:CCGGGCCAGCAGAAATCTGACTGTTCTCGAGAACAGTCAGATTTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-607s1c1
Sequence:CCGGCGGCTGAATACTTCCCTACTACTCGAGTAGTAGGGAAGTATTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-881s1c1
Sequence:CCGGGACGAACTTTATCCACCTCATCTCGAGATGAGGTGGATAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-548s1c1
Sequence:CCGGTCAGACCTATTATTCCAACTTCTCGAGAAGTTGGAATAATAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-1556s1c1
Sequence:CCGGCCACCCAAATGACCAGTACAACTCGAGTTGTACTGGTCATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130094
CERCAM MISSION shRNA shRNA Plasmid DNA
cerebral endothelial cell adhesion molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130094.4-2121s1c1
Sequence:CCGGGCCAGCAGAAATCTGACTGTTCTCGAGAACAGTCAGATTTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-607s1c1
Sequence:CCGGCGGCTGAATACTTCCCTACTACTCGAGTAGTAGGGAAGTATTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-881s1c1
Sequence:CCGGGACGAACTTTATCCACCTCATCTCGAGATGAGGTGGATAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-548s1c1
Sequence:CCGGTCAGACCTATTATTCCAACTTCTCGAGAAGTTGGAATAATAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-1556s1c1
Sequence:CCGGCCACCCAAATGACCAGTACAACTCGAGTTGTACTGGTCATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130094
CERCAM MISSION shRNA Lentiviral Transduction Particles
cerebral endothelial cell adhesion molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130094.4-2121s1c1
Sequence:CCGGGCCAGCAGAAATCTGACTGTTCTCGAGAACAGTCAGATTTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-607s1c1
Sequence:CCGGCGGCTGAATACTTCCCTACTACTCGAGTAGTAGGGAAGTATTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-881s1c1
Sequence:CCGGGACGAACTTTATCCACCTCATCTCGAGATGAGGTGGATAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-548s1c1
Sequence:CCGGTCAGACCTATTATTCCAACTTCTCGAGAAGTTGGAATAATAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130094.4-1556s1c1
Sequence:CCGGCCACCCAAATGACCAGTACAACTCGAGTTGTACTGGTCATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks