EMAIL THIS PAGE TO A FRIEND

CERK

ceramide kinase

Synonyms: LK4 dA59H18.2 dA59H18.3 hCERK
UniProtKB ID: Q8TCT0, A0JNT4, A8K611, Q9BYB3, Q9UGE5
Gene ID:
Human(64781) Summary: CERK converts ceramide to ceramide 1-phosphate (C1P), a sphingolipid metabolite. Both CERK and C1P have been implicated in various cellular processes, including proliferation, apoptosis, phagocytosis, and inflammation (Kim et al., 2006 [PubMed 16488390]
Mouse(223753) ceramide kinase
Rat(300129) ceramide kinase
sheep(101111625) ceramide kinase
Domestic Rabbit(100359094) ceramide kinase
naked mole-rat(101720871) ceramide kinase
Zebrafish(558496) ceramide kinase
cow(100336737) ceramide kinase
Horse(100053604) ceramide kinase
chicken(425523) ceramide kinase
fruit fly(40640) Ceramide kinase
dog(474464) ceramide kinase
domestic cat(101098065) ceramide kinase
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022766 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022766 siRNAs that have been validated in the lab human pricing
NM_182661 Rosetta Predictions human pricing
NM_001134861 Rosetta Predictions rat pricing
XM_001078468 Rosetta Predictions rat pricing
NM_145475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022766 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106857 validated 2131
1 SASI_Hs01_00106856 validated 2217
2 SASI_Hs02_00356040 predicted 1368
3 SASI_Hs02_00356041 predicted 495
4 SASI_Hs02_00356042 predicted 1478
5 SASI_Hs02_00356043 predicted 599
6 SASI_Hs01_00106860 predicted 1777
7 SASI_Hs02_00356044 predicted 715
8 SASI_Hs02_00356045 predicted 486
9 SASI_Hs02_00356046 predicted 1464
10 SASI_Hs02_00356047 predicted 1147
11 SASI_Hs02_00356048 predicted 601
12 SASI_Hs01_00106858 predicted 2089
13 SASI_Hs01_00106859 predicted 2024
14 SASI_Hs01_00106861 predicted 2033
15 SASI_Hs01_00106862 predicted 1926
16 SASI_Hs01_00106863 predicted 1990
17 SASI_Hs01_00106864 predicted 2001
18 SASI_Hs01_00106865 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026881 predicted 1598
2 SASI_Hs01_00026882 predicted 1596
3 SASI_Hs01_00026883 predicted 1362
4 SASI_Hs01_00026884 predicted 1440
5 SASI_Hs01_00026885 predicted 1042
6 SASI_Hs01_00026886 predicted 1199
7 SASI_Hs01_00026887 predicted 1508
8 SASI_Hs01_00026888 predicted 1020
9 SASI_Hs01_00026889 predicted 1497
10 SASI_Hs01_00026890 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258814 predicted 1925
2 SASI_Rn02_00258815 predicted 1408
3 SASI_Rn02_00258816 predicted 1183
4 SASI_Rn02_00258817 predicted 1502
5 SASI_Rn02_00258818 predicted 1581
6 SASI_Rn02_00258819 predicted 1882
7 SASI_Rn02_00258820 predicted 1135
8 SASI_Rn02_00258821 predicted 1527
9 SASI_Rn02_00258822 predicted 1611
10 SASI_Rn02_00258823 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360867 predicted 1926
2 SASI_Rn02_00360868 predicted 1409
3 SASI_Rn02_00360869 predicted 1177
4 SASI_Rn02_00360870 predicted 1504
5 SASI_Rn02_00360871 predicted 1576
6 SASI_Rn02_00360872 predicted 1874
7 SASI_Rn02_00360873 predicted 1133
8 SASI_Rn02_00360874 predicted 1522
9 SASI_Rn02_00360875 predicted 1612
10 SASI_Rn02_00360876 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173623 predicted 1739
2 SASI_Mm01_00173624 predicted 1419
3 SASI_Mm01_00173625 predicted 748
4 SASI_Mm01_00173626 predicted 2163
5 SASI_Mm01_00173627 predicted 2018
6 SASI_Mm01_00173628 predicted 1376
7 SASI_Mm01_00173629 predicted 1847
8 SASI_Mm01_00173630 predicted 1888
9 SASI_Mm01_00173631 predicted 1830
10 SASI_Mm01_00173632 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182661
VALIDATED
CERK MISSION shRNA Bacterial Glycerol Stock
ceramide kinase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-1197s1c1
Sequence:CCGGTCCAGATTTGTCCTTGTCTTTCTCGAGAAAGACAAGGACAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1313s1c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-981s1c1
Sequence:CCGGCACGGATGATAAGCTCTGGAACTCGAGTTCCAGAGCTTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-925s1c1
Sequence:CCGGGCGGCGAGGCTACGACAATCCCTCGAGGGATTGTCGTAGCCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1501s1c1
Sequence:CCGGCGGCTTAAACTTTGATCTGTACTCGAGTACAGATCAAAGTTTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-2878s1c1
Sequence:CCGGCCTGAATACAATCTTGAGTAACTCGAGTTACTCAAGATTGTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-1598s1c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-2633s1c1
Sequence:CCGGCCGCTAGATAGGCTCTGATTTCTCGAGAAATCAGAGCCTATCTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1176s1c1
Sequence:CCGGGCCTGAAGTCTGTACACGTGGCTCGAGCCACGTGTACAGACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1283s1c1
Sequence:CCGGGCGTCTCGGATGTCTGTCTTTCTCGAGAAAGACAGACATCCGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-933s1c1
Sequence:CCGGGCTACGACAATCCGGCTGGGACTCGAGTCCCAGCCGGATTGTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1068s1c1
Sequence:CCGGCGACGCGAAGTGCTTAACACACTCGAGTGTGTTAAGCACTTCGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1002s1c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182661
VALIDATED
CERK MISSION shRNA shRNA Plasmid DNA
ceramide kinase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-1197s1c1
Sequence:CCGGTCCAGATTTGTCCTTGTCTTTCTCGAGAAAGACAAGGACAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1313s1c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-981s1c1
Sequence:CCGGCACGGATGATAAGCTCTGGAACTCGAGTTCCAGAGCTTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-925s1c1
Sequence:CCGGGCGGCGAGGCTACGACAATCCCTCGAGGGATTGTCGTAGCCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1501s1c1
Sequence:CCGGCGGCTTAAACTTTGATCTGTACTCGAGTACAGATCAAAGTTTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-2878s1c1
Sequence:CCGGCCTGAATACAATCTTGAGTAACTCGAGTTACTCAAGATTGTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-1598s1c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-2633s1c1
Sequence:CCGGCCGCTAGATAGGCTCTGATTTCTCGAGAAATCAGAGCCTATCTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1176s1c1
Sequence:CCGGGCCTGAAGTCTGTACACGTGGCTCGAGCCACGTGTACAGACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1283s1c1
Sequence:CCGGGCGTCTCGGATGTCTGTCTTTCTCGAGAAAGACAGACATCCGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-933s1c1
Sequence:CCGGGCTACGACAATCCGGCTGGGACTCGAGTCCCAGCCGGATTGTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1068s1c1
Sequence:CCGGCGACGCGAAGTGCTTAACACACTCGAGTGTGTTAAGCACTTCGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1002s1c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182661
VALIDATED
CERK MISSION shRNA Lentiviral Transduction Particles
ceramide kinase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-1197s1c1
Sequence:CCGGTCCAGATTTGTCCTTGTCTTTCTCGAGAAAGACAAGGACAAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1313s1c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182661.1-981s1c1
Sequence:CCGGCACGGATGATAAGCTCTGGAACTCGAGTTCCAGAGCTTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-925s1c1
Sequence:CCGGGCGGCGAGGCTACGACAATCCCTCGAGGGATTGTCGTAGCCTCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1501s1c1
Sequence:CCGGCGGCTTAAACTTTGATCTGTACTCGAGTACAGATCAAAGTTTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-2878s1c1
Sequence:CCGGCCTGAATACAATCTTGAGTAACTCGAGTTACTCAAGATTGTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182661.1-1598s1c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-2633s1c1
Sequence:CCGGCCGCTAGATAGGCTCTGATTTCTCGAGAAATCAGAGCCTATCTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1176s1c1
Sequence:CCGGGCCTGAAGTCTGTACACGTGGCTCGAGCCACGTGTACAGACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_182661.1-1283s1c1
Sequence:CCGGGCGTCTCGGATGTCTGTCTTTCTCGAGAAAGACAGACATCCGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_182661.1-933s1c1
Sequence:CCGGGCTACGACAATCCGGCTGGGACTCGAGTCCCAGCCGGATTGTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1068s1c1
Sequence:CCGGCGACGCGAAGTGCTTAACACACTCGAGTGTGTTAAGCACTTCGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182661.1-1002s1c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145475
CERK MISSION shRNA Bacterial Glycerol Stock
ceramide kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1142s1c1
Sequence:CCGGGACTTAATCAAGGACAGTGAACTCGAGTTCACTGTCCTTGATTAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-978s1c1
Sequence:CCGGCCACAGATTGTGTGTGTTACTCTCGAGAGTAACACACACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1606s1c1
Sequence:CCGGCGTTGAAGTTTATCGAGTCAACTCGAGTTGACTCGATAAACTTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-802s1c1
Sequence:CCGGCGAGATCAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1189s1c1
Sequence:CCGGGTATGATTTCTCAGGGTTGAACTCGAGTTCAACCCTGAGAAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-703s21c1
Sequence:CCGGTCCAGTGGCCGATGGCATAAACTCGAGTTTATGCCATCGGCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1259s21c1
Sequence:CCGGCATCGGCTTTGCACATCATTACTCGAGTAATGATGTGCAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1507s21c1
Sequence:CCGGGGATCTCCACGGGACAATAAACTCGAGTTTATTGTCCCGTGGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-980s21c1
Sequence:CCGGTCACTACGGAGATCATCATTACTCGAGTAATGATGATCTCCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145475
CERK MISSION shRNA shRNA Plasmid DNA
ceramide kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1142s1c1
Sequence:CCGGGACTTAATCAAGGACAGTGAACTCGAGTTCACTGTCCTTGATTAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-978s1c1
Sequence:CCGGCCACAGATTGTGTGTGTTACTCTCGAGAGTAACACACACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1606s1c1
Sequence:CCGGCGTTGAAGTTTATCGAGTCAACTCGAGTTGACTCGATAAACTTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-802s1c1
Sequence:CCGGCGAGATCAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1189s1c1
Sequence:CCGGGTATGATTTCTCAGGGTTGAACTCGAGTTCAACCCTGAGAAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-703s21c1
Sequence:CCGGTCCAGTGGCCGATGGCATAAACTCGAGTTTATGCCATCGGCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1259s21c1
Sequence:CCGGCATCGGCTTTGCACATCATTACTCGAGTAATGATGTGCAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1507s21c1
Sequence:CCGGGGATCTCCACGGGACAATAAACTCGAGTTTATTGTCCCGTGGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-980s21c1
Sequence:CCGGTCACTACGGAGATCATCATTACTCGAGTAATGATGATCTCCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145475
CERK MISSION shRNA Lentiviral Transduction Particles
ceramide kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1142s1c1
Sequence:CCGGGACTTAATCAAGGACAGTGAACTCGAGTTCACTGTCCTTGATTAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-978s1c1
Sequence:CCGGCCACAGATTGTGTGTGTTACTCTCGAGAGTAACACACACAATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1606s1c1
Sequence:CCGGCGTTGAAGTTTATCGAGTCAACTCGAGTTGACTCGATAAACTTCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-802s1c1
Sequence:CCGGCGAGATCAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145475.2-1189s1c1
Sequence:CCGGGTATGATTTCTCAGGGTTGAACTCGAGTTCAACCCTGAGAAATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-703s21c1
Sequence:CCGGTCCAGTGGCCGATGGCATAAACTCGAGTTTATGCCATCGGCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1259s21c1
Sequence:CCGGCATCGGCTTTGCACATCATTACTCGAGTAATGATGTGCAAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-1507s21c1
Sequence:CCGGGGATCTCCACGGGACAATAAACTCGAGTTTATTGTCCCGTGGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145475.3-980s21c1
Sequence:CCGGTCACTACGGAGATCATCATTACTCGAGTAATGATGATCTCCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022766
CERK MISSION shRNA Bacterial Glycerol Stock
ceramide kinase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2736s21c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2645s21c1
Sequence:CCGGCACACTGAGTTCTCTATATTTCTCGAGAAATATAGAGAACTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2444s21c1
Sequence:CCGGCTGGCAAGTTTGTTACTGTTACTCGAGTAACAGTAACAAACTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-3021s21c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2425s21c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022766
CERK MISSION shRNA shRNA Plasmid DNA
ceramide kinase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2736s21c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2645s21c1
Sequence:CCGGCACACTGAGTTCTCTATATTTCTCGAGAAATATAGAGAACTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2444s21c1
Sequence:CCGGCTGGCAAGTTTGTTACTGTTACTCGAGTAACAGTAACAAACTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-3021s21c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2425s21c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022766
CERK MISSION shRNA Lentiviral Transduction Particles
ceramide kinase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2736s21c1
Sequence:CCGGGCCACGATGGATCGCTGGTTTCTCGAGAAACCAGCGATCCATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2645s21c1
Sequence:CCGGCACACTGAGTTCTCTATATTTCTCGAGAAATATAGAGAACTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2444s21c1
Sequence:CCGGCTGGCAAGTTTGTTACTGTTACTCGAGTAACAGTAACAAACTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-3021s21c1
Sequence:CCGGCCCTTAGTGATTTCATGTTTACTCGAGTAAACATGAAATCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022766.5-2425s21c1
Sequence:CCGGGCTGGCAGTGTGTAAAGCACTCTCGAGAGTGCTTTACACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks