EMAIL THIS PAGE TO A FRIEND

CERKL

ceramide kinase-like

135 Gene Product Result for
Synonyms: RP26
Gene ID:
Human(375298) Summary: This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
Mouse(228094) ceramide kinase-like
Rat(502640) ceramide kinase-like
Zebrafish(100037318) ceramide kinase-like
cow(100337174) ceramide kinase-like
domestic cat(101096337) ceramide kinase-like
dog(488430) ceramide kinase-like
chicken(424120) ceramide kinase-like
domestic guinea pig(100718349) ceramide kinase-like
naked mole-rat(101708888) ceramide kinase-like
sheep(101123449) ceramide kinase-like
Domestic Rabbit(100346364) ceramide kinase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001048176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_149165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150661 MISSION® esiRNA esiRNA human CERKL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030311 Rosetta Predictions human pricing
NM_001030312 Rosetta Predictions human pricing
NM_001030313 Rosetta Predictions human pricing
NM_001030314 Rosetta Predictions human pricing
NM_001030315 Rosetta Predictions human pricing
NM_201548 Rosetta Predictions human pricing
XM_578135 Rosetta Predictions rat pricing
XR_008419 Rosetta Predictions rat pricing
NM_001033295 Rosetta Predictions mouse pricing
NM_001048176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163455 predicted 1323
2 SASI_Hs01_00163456 predicted 1292
3 SASI_Hs01_00163457 predicted 1222
4 SASI_Hs01_00163458 predicted 1180
5 SASI_Hs01_00163459 predicted 1348
6 SASI_Hs01_00163460 predicted 1179
7 SASI_Hs01_00163462 predicted 245
8 SASI_Hs01_00163463 predicted 1095
9 SASI_Hs02_00307647 predicted 1262
10 SASI_Hs02_00307648 predicted 1292
11 SASI_Hs01_00163461 predicted 1208
12 SASI_Hs01_00163464 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100561 predicted 907
2 SASI_Hs01_00100562 predicted 869
3 SASI_Hs01_00100563 predicted 806
4 SASI_Hs01_00100564 predicted 766
5 SASI_Hs01_00100565 predicted 931
6 SASI_Hs01_00100566 predicted 755
7 SASI_Hs01_00100568 predicted 239
8 SASI_Hs01_00100569 predicted 679
9 SASI_Hs02_00307649 predicted 849
10 SASI_Hs02_00307650 predicted 875
11 SASI_Hs01_00100567 predicted 786
12 SASI_Hs01_00100570 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141121 predicted 1040
2 SASI_Hs01_00141122 predicted 1003
3 SASI_Hs01_00141123 predicted 939
4 SASI_Hs01_00141124 predicted 897
5 SASI_Hs01_00141125 predicted 1071
6 SASI_Hs01_00141126 predicted 885
7 SASI_Hs01_00141128 predicted 247
8 SASI_Hs01_00141129 predicted 816
9 SASI_Hs01_00141130 predicted 977
10 SASI_Hs02_00307651 predicted 1004
11 SASI_Hs01_00141127 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208494 predicted 1018
2 SASI_Hs01_00208495 predicted 954
3 SASI_Hs01_00208496 predicted 913
4 SASI_Hs01_00208497 predicted 910
5 SASI_Hs01_00208498 predicted 928
6 SASI_Hs01_00208499 predicted 251
7 SASI_Hs01_00208500 predicted 827
8 SASI_Hs01_00208501 predicted 885
9 SASI_Hs01_00208502 predicted 977
10 SASI_Hs01_00208503 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199864 predicted 1157
2 SASI_Hs01_00199865 predicted 1085
3 SASI_Hs01_00199866 predicted 1047
4 SASI_Hs01_00199867 predicted 1033
5 SASI_Hs01_00199868 predicted 1062
6 SASI_Hs01_00199869 predicted 250
7 SASI_Hs01_00199870 predicted 959
8 SASI_Hs01_00199871 predicted 1008
9 SASI_Hs01_00199872 predicted 1116
10 SASI_Hs01_00199873 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192034 predicted 1270
2 SASI_Hs01_00192035 predicted 1228
3 SASI_Hs01_00192036 predicted 1163
4 SASI_Hs01_00192037 predicted 1124
5 SASI_Hs01_00192038 predicted 1288
6 SASI_Hs01_00192039 predicted 1116
7 SASI_Hs01_00192041 predicted 264
8 SASI_Hs01_00192042 predicted 1041
9 SASI_Hs01_00192043 predicted 1204
10 SASI_Hs02_00373035 predicted 1230
11 SASI_Hs01_00192040 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407629 predicted 504
2 SASI_Rn02_00407630 predicted 206
3 SASI_Rn02_00407631 predicted 399
4 SASI_Rn02_00407632 predicted 549
5 SASI_Rn02_00407633 predicted 539
6 SASI_Rn02_00407634 predicted 453
7 SASI_Rn02_00407635 predicted 499
8 SASI_Rn02_00407636 predicted 239
9 SASI_Rn02_00407637 predicted 560
10 SASI_Rn02_00407638 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00416984 predicted 498
2 SASI_Rn02_00416985 predicted 205
3 SASI_Rn01_00193378 predicted 406
4 SASI_Rn02_00416986 predicted 555
5 SASI_Rn02_00416987 predicted 540
6 SASI_Rn02_00416988 predicted 458
7 SASI_Rn02_00416989 predicted 499
8 SASI_Rn02_00416990 predicted 234
9 SASI_Rn02_00416991 predicted 561
10 SASI_Rn02_00416992 predicted 458
11 SASI_Rn01_00193375 predicted 1207
12 SASI_Rn01_00193376 predicted 968
13 SASI_Rn01_00193377 predicted 946
14 SASI_Rn01_00193379 predicted 1027
15 SASI_Rn01_00193380 predicted 674
16 SASI_Rn01_00193381 predicted 806
17 SASI_Rn01_00193382 predicted 1268
18 SASI_Rn01_00193383 predicted 821
19 SASI_Rn01_00193384 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181834 predicted 705
2 SASI_Mm01_00181835 predicted 743
3 SASI_Mm01_00181836 predicted 709
4 SASI_Mm01_00181837 predicted 533
5 SASI_Mm01_00181838 predicted 754
6 SASI_Mm01_00181839 predicted 618
7 SASI_Mm01_00181840 predicted 607
8 SASI_Mm01_00181841 predicted 692
9 SASI_Mm01_00181842 predicted 590
10 SASI_Mm01_00181843 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292120 predicted 489
2 SASI_Mm02_00292121 predicted 484
3 SASI_Mm02_00292122 predicted 931
4 SASI_Mm02_00292123 predicted 878
5 SASI_Mm02_00292124 predicted 1510
6 SASI_Mm02_00292125 predicted 1044
7 SASI_Mm02_00292126 predicted 714
8 SASI_Mm02_00292127 predicted 1294
9 SASI_Mm02_00292128 predicted 1431
10 SASI_Mm02_00292129 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048176
CERKL MISSION shRNA Bacterial Glycerol Stock
ceramide kinase-like
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000367955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-589s21c1
Sequence:CCGGGGAGTCTGTCCACGTCTATTACTCGAGTAATAGACGTGGACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-453s21c1
Sequence:CCGGACTCCACGCTGGATCTTATTACTCGAGTAATAAGATCCAGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-860s21c1
Sequence:CCGGATTCCAGCAGGATCTACTAACCTCGAGGTTAGTAGATCCTGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048176
CERKL MISSION shRNA shRNA Plasmid DNA
ceramide kinase-like
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000367955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-589s21c1
Sequence:CCGGGGAGTCTGTCCACGTCTATTACTCGAGTAATAGACGTGGACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-453s21c1
Sequence:CCGGACTCCACGCTGGATCTTATTACTCGAGTAATAAGATCCAGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-860s21c1
Sequence:CCGGATTCCAGCAGGATCTACTAACCTCGAGGTTAGTAGATCCTGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048176
CERKL MISSION shRNA Lentiviral Transduction Particles
ceramide kinase-like
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000367955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-589s21c1
Sequence:CCGGGGAGTCTGTCCACGTCTATTACTCGAGTAATAGACGTGGACAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-453s21c1
Sequence:CCGGACTCCACGCTGGATCTTATTACTCGAGTAATAAGATCCAGCGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048176.1-860s21c1
Sequence:CCGGATTCCAGCAGGATCTACTAACCTCGAGGTTAGTAGATCCTGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201548
CERKL MISSION shRNA Bacterial Glycerol Stock
ceramide kinase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-681s1c1
Sequence:CCGGCCAGGGATTTGATGGTGTTGTCTCGAGACAACACCATCAAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1262s1c1
Sequence:CCGGCTAGAGGCTTGGCACCTAATACTCGAGTATTAGGTGCCAAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-595s1c1
Sequence:CCGGCTGTTGAAGCTTGCAGGAATACTCGAGTATTCCTGCAAGCTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-811s1c1
Sequence:CCGGCAGCTTCCACTTGGCTTAATACTCGAGTATTAAGCCAAGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1942s1c1
Sequence:CCGGCCAAACGGATATCCTAATAGACTCGAGTCTATTAGGATATCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1564s1c1
Sequence:CCGGCCAAGACTTATCAGTCTTTATCTCGAGATAAAGACTGATAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-856s1c1
Sequence:CCGGGCACATTCTCTTCATGGAGTTCTCGAGAACTCCATGAAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1853s1c1
Sequence:CCGGCGCACTTCTATGAGAATCTAACTCGAGTTAGATTCTCATAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1273s1c1
Sequence:CCGGGCACCTAATACCAGATTAAATCTCGAGATTTAATCTGGTATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1543s1c1
Sequence:CCGGGAGGTCCATATTAGATTGCATCTCGAGATGCAATCTAATATGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201548
CERKL MISSION shRNA shRNA Plasmid DNA
ceramide kinase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-681s1c1
Sequence:CCGGCCAGGGATTTGATGGTGTTGTCTCGAGACAACACCATCAAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1262s1c1
Sequence:CCGGCTAGAGGCTTGGCACCTAATACTCGAGTATTAGGTGCCAAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-595s1c1
Sequence:CCGGCTGTTGAAGCTTGCAGGAATACTCGAGTATTCCTGCAAGCTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-811s1c1
Sequence:CCGGCAGCTTCCACTTGGCTTAATACTCGAGTATTAAGCCAAGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1942s1c1
Sequence:CCGGCCAAACGGATATCCTAATAGACTCGAGTCTATTAGGATATCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1564s1c1
Sequence:CCGGCCAAGACTTATCAGTCTTTATCTCGAGATAAAGACTGATAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-856s1c1
Sequence:CCGGGCACATTCTCTTCATGGAGTTCTCGAGAACTCCATGAAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1853s1c1
Sequence:CCGGCGCACTTCTATGAGAATCTAACTCGAGTTAGATTCTCATAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1273s1c1
Sequence:CCGGGCACCTAATACCAGATTAAATCTCGAGATTTAATCTGGTATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1543s1c1
Sequence:CCGGGAGGTCCATATTAGATTGCATCTCGAGATGCAATCTAATATGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201548
CERKL MISSION shRNA Lentiviral Transduction Particles
ceramide kinase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-681s1c1
Sequence:CCGGCCAGGGATTTGATGGTGTTGTCTCGAGACAACACCATCAAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1262s1c1
Sequence:CCGGCTAGAGGCTTGGCACCTAATACTCGAGTATTAGGTGCCAAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-595s1c1
Sequence:CCGGCTGTTGAAGCTTGCAGGAATACTCGAGTATTCCTGCAAGCTTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-811s1c1
Sequence:CCGGCAGCTTCCACTTGGCTTAATACTCGAGTATTAAGCCAAGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1942s1c1
Sequence:CCGGCCAAACGGATATCCTAATAGACTCGAGTCTATTAGGATATCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1564s1c1
Sequence:CCGGCCAAGACTTATCAGTCTTTATCTCGAGATAAAGACTGATAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-856s1c1
Sequence:CCGGGCACATTCTCTTCATGGAGTTCTCGAGAACTCCATGAAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201548.3-1853s1c1
Sequence:CCGGCGCACTTCTATGAGAATCTAACTCGAGTTAGATTCTCATAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1273s1c1
Sequence:CCGGGCACCTAATACCAGATTAAATCTCGAGATTTAATCTGGTATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201548.3-1543s1c1
Sequence:CCGGGAGGTCCATATTAGATTGCATCTCGAGATGCAATCTAATATGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149165
CERKL MISSION shRNA Bacterial Glycerol Stock
ceramide kinase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1465s1c1
Sequence:CCGGCCACTCGATCAGAATTTGTAACTCGAGTTACAAATTCTGATCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1707s1c1
Sequence:CCGGCCAAGACTGATCAGGCTCTATCTCGAGATAGAGCCTGATCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1029s1c1
Sequence:CCGGGCAACCATGCATATTATACTACTCGAGTAGTATAATATGCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1187s1c1
Sequence:CCGGGCGAAGAGACTTTGCTATAATCTCGAGATTATAGCAAAGTCTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1536s1c1
Sequence:CCGGGTGGAGACTTATATCATTGAACTCGAGTTCAATGATATAAGTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149165
CERKL MISSION shRNA shRNA Plasmid DNA
ceramide kinase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1465s1c1
Sequence:CCGGCCACTCGATCAGAATTTGTAACTCGAGTTACAAATTCTGATCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1707s1c1
Sequence:CCGGCCAAGACTGATCAGGCTCTATCTCGAGATAGAGCCTGATCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1029s1c1
Sequence:CCGGGCAACCATGCATATTATACTACTCGAGTAGTATAATATGCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1187s1c1
Sequence:CCGGGCGAAGAGACTTTGCTATAATCTCGAGATTATAGCAAAGTCTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1536s1c1
Sequence:CCGGGTGGAGACTTATATCATTGAACTCGAGTTCAATGATATAAGTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149165
CERKL MISSION shRNA Lentiviral Transduction Particles
ceramide kinase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1465s1c1
Sequence:CCGGCCACTCGATCAGAATTTGTAACTCGAGTTACAAATTCTGATCGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1707s1c1
Sequence:CCGGCCAAGACTGATCAGGCTCTATCTCGAGATAGAGCCTGATCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1029s1c1
Sequence:CCGGGCAACCATGCATATTATACTACTCGAGTAGTATAATATGCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1187s1c1
Sequence:CCGGGCGAAGAGACTTTGCTATAATCTCGAGATTATAGCAAAGTCTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149165.3-1536s1c1
Sequence:CCGGGTGGAGACTTATATCATTGAACTCGAGTTCAATGATATAAGTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks