EMAIL THIS PAGE TO A FRIEND

CERS1

ceramide synthase 1

72 Gene Product Result for
Synonyms: LAG1 LASS1 UOG1
UniProtKB ID: P27544
Gene ID:
Human(10715) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site that is cleaved to produce a mature protein containing seven conserved cysteine residues. Members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in yeast suggest that the encoded protein is involved in aging. This protein is transcribed from a monocistronic mRNA as well as a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2008]
Mouse(93898) ceramide synthase 1
Rat(290658) ceramide synthase 1
sheep(101107095) ceramide synthase 1
naked mole-rat(101705418) ceramide synthase 1
domestic guinea pig(100720321) ceramide synthase 1
Zebrafish(568169) ceramide synthase 1
chicken(420118) ceramide synthase 1
dog(609789) ceramide synthase 1
cow(615296) ceramide synthase 1
domestic cat(101089084) ceramide synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016651 MISSION® esiRNA esiRNA targeting human GDF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021267 Rosetta Predictions human pricing
NM_198207 Rosetta Predictions human pricing
NM_001044230 Rosetta Predictions rat pricing
XM_224734 Rosetta Predictions rat pricing
NM_138647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032899 predicted 554
2 SASI_Hs02_00354924 predicted 456
3 SASI_Hs02_00354925 predicted 464
4 SASI_Hs01_00032901 predicted 718
5 SASI_Hs01_00032902 predicted 514
6 SASI_Hs01_00032903 predicted 826
7 SASI_Hs01_00032905 predicted 508
8 SASI_Hs01_00032906 predicted 639
9 SASI_Hs01_00032907 predicted 653
10 SASI_Hs01_00032908 predicted 835
11 SASI_Hs01_00032900 predicted 544
12 SASI_Hs01_00032904 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150428 predicted 553
2 SASI_Hs02_00371742 predicted 462
3 SASI_Hs02_00371743 predicted 461
4 SASI_Hs01_00150430 predicted 721
5 SASI_Hs01_00150431 predicted 519
6 SASI_Hs01_00150432 predicted 828
7 SASI_Hs01_00150434 predicted 502
8 SASI_Hs01_00150435 predicted 641
9 SASI_Hs01_00150436 predicted 657
10 SASI_Hs01_00150437 predicted 831
11 SASI_Hs01_00150429 predicted 538
12 SASI_Hs01_00150433 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205027 predicted 1314
2 SASI_Rn02_00205028 predicted 1413
3 SASI_Rn02_00205029 predicted 761
4 SASI_Rn02_00205030 predicted 442
5 SASI_Rn02_00205031 predicted 577
6 SASI_Rn02_00205032 predicted 1011
7 SASI_Rn02_00205033 predicted 656
8 SASI_Rn02_00205034 predicted 823
9 SASI_Rn02_00205035 predicted 1037
10 SASI_Rn02_00205036 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170346 predicted 803
2 SASI_Rn01_00170347 predicted 797
3 SASI_Rn01_00170348 predicted 810
4 SASI_Rn01_00170349 predicted 761
5 SASI_Rn01_00170350 predicted 809
6 SASI_Rn01_00170351 predicted 825
7 SASI_Rn01_00170352 predicted 801
8 SASI_Rn01_00170353 predicted 818
9 SASI_Rn01_00170354 predicted 769
10 SASI_Rn01_00170355 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055007 predicted 1045
2 SASI_Mm02_00339695 predicted 856
3 SASI_Mm01_00055008 predicted 395
4 SASI_Mm02_00339696 predicted 1043
5 SASI_Mm02_00339697 predicted 392
6 SASI_Mm01_00055010 predicted 860
7 SASI_Mm01_00055011 predicted 498
8 SASI_Mm01_00055012 predicted 893
9 SASI_Mm01_00055013 predicted 984
10 SASI_Mm01_00055014 predicted 789
11 SASI_Mm01_00055006 predicted 118
12 SASI_Mm01_00055009 predicted 1300
13 SASI_Mm01_00055015 predicted 1352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021267
VALIDATED
CERS1 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-721s1c1
Sequence:CCGGGAGTTCACCAAGCTCAACATTCTCGAGAATGTTGAGCTTGGTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-723s1c1
Sequence:CCGGGTTCACCAAGCTCAACATTTACTCGAGTAAATGTTGAGCTTGGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-948s1c1
Sequence:CCGGCCTTATGAACCTCTACTGGTTCTCGAGAACCAGTAGAGGTTCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021267.2-912s1c1
Sequence:CCGGCTACTTCTTCTTCAATGCGCTCTCGAGAGCGCATTGAAGAAGAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021267.2-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-717s1c1
Sequence:CCGGGCTTGAGTTCACCAAGCTCAACTCGAGTTGAGCTTGGTGAACTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-947s1c1
Sequence:CCGGCCCTTATGAACCTCTACTGGTCTCGAGACCAGTAGAGGTTCATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021267
VALIDATED
CERS1 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-721s1c1
Sequence:CCGGGAGTTCACCAAGCTCAACATTCTCGAGAATGTTGAGCTTGGTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-723s1c1
Sequence:CCGGGTTCACCAAGCTCAACATTTACTCGAGTAAATGTTGAGCTTGGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-948s1c1
Sequence:CCGGCCTTATGAACCTCTACTGGTTCTCGAGAACCAGTAGAGGTTCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021267.2-912s1c1
Sequence:CCGGCTACTTCTTCTTCAATGCGCTCTCGAGAGCGCATTGAAGAAGAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021267.2-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-717s1c1
Sequence:CCGGGCTTGAGTTCACCAAGCTCAACTCGAGTTGAGCTTGGTGAACTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-947s1c1
Sequence:CCGGCCCTTATGAACCTCTACTGGTCTCGAGACCAGTAGAGGTTCATAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021267
VALIDATED
CERS1 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-721s1c1
Sequence:CCGGGAGTTCACCAAGCTCAACATTCTCGAGAATGTTGAGCTTGGTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021267.2-723s1c1
Sequence:CCGGGTTCACCAAGCTCAACATTTACTCGAGTAAATGTTGAGCTTGGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-948s1c1
Sequence:CCGGCCTTATGAACCTCTACTGGTTCTCGAGAACCAGTAGAGGTTCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021267.2-912s1c1
Sequence:CCGGCTACTTCTTCTTCAATGCGCTCTCGAGAGCGCATTGAAGAAGAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021267.2-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-717s1c1
Sequence:CCGGGCTTGAGTTCACCAAGCTCAACTCGAGTTGAGCTTGGTGAACTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021267.2-947s1c1
Sequence:CCGGCCCTTATGAACCTCTACTGGTCTCGAGACCAGTAGAGGTTCATAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138647
CERS1 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138647.1-1290s1c1
Sequence:CCGGGCCCTAAGATTCAGGATGCTACTCGAGTAGCATCCTGAATCTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-898s1c1
Sequence:CCGGGCCTGACATTCCGTACTACTTCTCGAGAAGTAGTACGGAATGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-110s1c1
Sequence:CCGGCCAGAGCCCATGCCGAGTTATCTCGAGATAACTCGGCATGGGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-943s1c1
Sequence:CCGGCCTGATGGTCATGAACATCTACTCGAGTAGATGTTCATGACCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-541s1c1
Sequence:CCGGGAGTTTCTACTGCCACTCCATCTCGAGATGGAGTGGCAGTAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138647
CERS1 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138647.1-1290s1c1
Sequence:CCGGGCCCTAAGATTCAGGATGCTACTCGAGTAGCATCCTGAATCTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-898s1c1
Sequence:CCGGGCCTGACATTCCGTACTACTTCTCGAGAAGTAGTACGGAATGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-110s1c1
Sequence:CCGGCCAGAGCCCATGCCGAGTTATCTCGAGATAACTCGGCATGGGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-943s1c1
Sequence:CCGGCCTGATGGTCATGAACATCTACTCGAGTAGATGTTCATGACCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-541s1c1
Sequence:CCGGGAGTTTCTACTGCCACTCCATCTCGAGATGGAGTGGCAGTAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138647
CERS1 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138647.1-1290s1c1
Sequence:CCGGGCCCTAAGATTCAGGATGCTACTCGAGTAGCATCCTGAATCTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-898s1c1
Sequence:CCGGGCCTGACATTCCGTACTACTTCTCGAGAAGTAGTACGGAATGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-110s1c1
Sequence:CCGGCCAGAGCCCATGCCGAGTTATCTCGAGATAACTCGGCATGGGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-943s1c1
Sequence:CCGGCCTGATGGTCATGAACATCTACTCGAGTAGATGTTCATGACCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138647.1-541s1c1
Sequence:CCGGGAGTTTCTACTGCCACTCCATCTCGAGATGGAGTGGCAGTAGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)