EMAIL THIS PAGE TO A FRIEND

CERS2

ceramide synthase 2

Synonyms: L3 LASS2 SP260 TMSG1
UniProtKB ID: Q96G23, D3DV06, Q5SZE5, Q9HD96, Q9NW79
Gene ID:
Human(29956) Summary: This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(76893) ceramide synthase 2
Rat(310667) ceramide synthase 2
cow(539223) ceramide synthase 2
domestic cat(101094362) ceramide synthase 2
dog(483187) ceramide synthase 2
domestic guinea pig(100723224) ceramide synthase 2
naked mole-rat(101716285) ceramide synthase 2
sheep(101109498) ceramide synthase 2
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013384 Rosetta Predictions human pricing
NM_022075 Rosetta Predictions human pricing
NM_181746 Rosetta Predictions human pricing
NM_001033700 Rosetta Predictions rat pricing
NM_029789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056763 predicted 585
2 SASI_Hs01_00056764 predicted 596
3 SASI_Hs01_00056765 predicted 830
4 SASI_Hs01_00056766 predicted 1061
5 SASI_Hs01_00056767 predicted 575
6 SASI_Hs01_00056768 predicted 747
7 SASI_Hs01_00056769 predicted 666
8 SASI_Hs01_00056770 predicted 1168
9 SASI_Hs01_00056771 predicted 1175
10 SASI_Hs01_00056772 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215837 predicted 882
2 SASI_Hs01_00215838 predicted 883
3 SASI_Hs01_00215839 predicted 1120
4 SASI_Hs01_00215840 predicted 1351
5 SASI_Hs02_00355443 predicted 880
6 SASI_Hs01_00215841 predicted 860
7 SASI_Hs01_00215842 predicted 1039
8 SASI_Hs01_00215844 predicted 1458
9 SASI_Hs02_00355444 predicted 861
10 SASI_Hs01_00215845 predicted 1463
11 SASI_Hs01_00215843 predicted 841
12 SASI_Hs01_00215846 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076932 predicted 916
2 SASI_Hs01_00076933 predicted 926
3 SASI_Hs01_00076934 predicted 1159
4 SASI_Hs01_00076935 predicted 1391
5 SASI_Hs02_00370355 predicted 919
6 SASI_Hs01_00076936 predicted 906
7 SASI_Hs01_00076937 predicted 1081
8 SASI_Hs01_00076939 predicted 1494
9 SASI_Hs02_00370356 predicted 905
10 SASI_Hs01_00076940 predicted 1503
11 SASI_Hs01_00076938 predicted 882
12 SASI_Hs01_00076941 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203733 predicted 1042
2 SASI_Rn01_00095131 predicted 989
3 SASI_Rn02_00203734 predicted 1260
4 SASI_Rn01_00095132 predicted 628
5 SASI_Rn02_00203735 predicted 1094
6 SASI_Rn02_00203736 predicted 626
7 SASI_Rn01_00095133 predicted 576
8 SASI_Rn01_00095134 predicted 611
9 SASI_Rn02_00203737 predicted 599
10 SASI_Rn02_00203738 predicted 622
11 SASI_Rn01_00095127 predicted 543
12 SASI_Rn01_00095128 predicted 641
13 SASI_Rn01_00095129 predicted 919
14 SASI_Rn01_00095130 predicted 520
15 SASI_Rn01_00095135 predicted 457
16 SASI_Rn01_00095136 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335934 predicted 883
2 SASI_Mm01_00094734 predicted 639
3 SASI_Mm01_00094735 predicted 1331
4 SASI_Mm01_00094736 predicted 630
5 SASI_Mm02_00335935 predicted 521
6 SASI_Mm01_00094738 predicted 621
7 SASI_Mm01_00094739 predicted 250
8 SASI_Mm01_00094740 predicted 1206
9 SASI_Mm01_00094741 predicted 616
10 SASI_Mm01_00094742 predicted 894
11 SASI_Mm01_00094733 predicted 644
12 SASI_Mm01_00094737 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029789
VALIDATED
CERS2 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-1082s1c1
Sequence:CCGGCCCACAAGTTCATAACTGGAACTCGAGTTCCAGTTATGAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029789.1-1690s1c1
Sequence:CCGGCCAAGAAAGAAAGCTGAGCTACTCGAGTAGCTCAGCTTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-259s1c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-169s1c1
Sequence:CCGGGCTGATCTAGAAGACAAAGATCTCGAGATCTTTGTCTTCTAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-509s1c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-565s1c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-1215s1c1
Sequence:CCGGCCTCAATAACAATCATCCTAACTCGAGTTAGGATGATTGTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-1372s21c1
Sequence:CCGGTTTCACCCAGTTGCCTTTAAACTCGAGTTTAAAGGCAACTGGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-509s21c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-992s1c1
Sequence:CCGGCTGCCTTCTTTGGCTATTATTCTCGAGAATAATAGCCAAAGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029789.1-1534s1c1
Sequence:CCGGCATAACTCACATTCCTCATTCCTCGAGGAATGAGGAATGTGAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-954s21c1
Sequence:CCGGCCTACACTGCACGATGATATACTCGAGTATATCATCGTGCAGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-565s21c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-259s21c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029789
VALIDATED
CERS2 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-1082s1c1
Sequence:CCGGCCCACAAGTTCATAACTGGAACTCGAGTTCCAGTTATGAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029789.1-1690s1c1
Sequence:CCGGCCAAGAAAGAAAGCTGAGCTACTCGAGTAGCTCAGCTTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-259s1c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-169s1c1
Sequence:CCGGGCTGATCTAGAAGACAAAGATCTCGAGATCTTTGTCTTCTAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-509s1c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-565s1c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-1215s1c1
Sequence:CCGGCCTCAATAACAATCATCCTAACTCGAGTTAGGATGATTGTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-1372s21c1
Sequence:CCGGTTTCACCCAGTTGCCTTTAAACTCGAGTTTAAAGGCAACTGGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-509s21c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-992s1c1
Sequence:CCGGCTGCCTTCTTTGGCTATTATTCTCGAGAATAATAGCCAAAGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029789.1-1534s1c1
Sequence:CCGGCATAACTCACATTCCTCATTCCTCGAGGAATGAGGAATGTGAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-954s21c1
Sequence:CCGGCCTACACTGCACGATGATATACTCGAGTATATCATCGTGCAGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-565s21c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-259s21c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029789
VALIDATED
CERS2 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-1082s1c1
Sequence:CCGGCCCACAAGTTCATAACTGGAACTCGAGTTCCAGTTATGAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029789.1-1690s1c1
Sequence:CCGGCCAAGAAAGAAAGCTGAGCTACTCGAGTAGCTCAGCTTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-259s1c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-169s1c1
Sequence:CCGGGCTGATCTAGAAGACAAAGATCTCGAGATCTTTGTCTTCTAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-509s1c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029789.1-565s1c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029789.1-1215s1c1
Sequence:CCGGCCTCAATAACAATCATCCTAACTCGAGTTAGGATGATTGTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-1372s21c1
Sequence:CCGGTTTCACCCAGTTGCCTTTAAACTCGAGTTTAAAGGCAACTGGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-509s21c1
Sequence:CCGGCCAGCTGGAGATTCACGTATTCTCGAGAATACGTGAATCTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029789.1-992s1c1
Sequence:CCGGCTGCCTTCTTTGGCTATTATTCTCGAGAATAATAGCCAAAGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029789.1-1534s1c1
Sequence:CCGGCATAACTCACATTCCTCATTCCTCGAGGAATGAGGAATGTGAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-954s21c1
Sequence:CCGGCCTACACTGCACGATGATATACTCGAGTATATCATCGTGCAGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-565s21c1
Sequence:CCGGGTGGATAAACCCTGGTTCTATCTCGAGATAGAACCAGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029789.1-259s21c1
Sequence:CCGGCGATACTTCTTTGAGCTTTATCTCGAGATAAAGCTCAAAGAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013384
VALIDATED
CERS2 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1033s1c1
Sequence:CCGGCCACAAGTTCATAACTGGAAACTCGAGTTTCCAGTTATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-541s1c1
Sequence:CCGGGAAGAAAGTTTGGGAGGGATACTCGAGTATCCCTCCCAAACTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-749s1c1
Sequence:CCGGACTCTAATCATGGCTCTGCATCTCGAGATGCAGAGCCATGATTAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1165s1c1
Sequence:CCGGCCTCAATAACAACCATCGTAACTCGAGTTACGATGGTTGTTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013384.3-586s1c1
Sequence:CCGGCCAGTATTGGTACTACATGATCTCGAGATCATGTAGTACCAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013384
VALIDATED
CERS2 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1033s1c1
Sequence:CCGGCCACAAGTTCATAACTGGAAACTCGAGTTTCCAGTTATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-541s1c1
Sequence:CCGGGAAGAAAGTTTGGGAGGGATACTCGAGTATCCCTCCCAAACTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-749s1c1
Sequence:CCGGACTCTAATCATGGCTCTGCATCTCGAGATGCAGAGCCATGATTAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1165s1c1
Sequence:CCGGCCTCAATAACAACCATCGTAACTCGAGTTACGATGGTTGTTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013384.3-586s1c1
Sequence:CCGGCCAGTATTGGTACTACATGATCTCGAGATCATGTAGTACCAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013384
VALIDATED
CERS2 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1033s1c1
Sequence:CCGGCCACAAGTTCATAACTGGAAACTCGAGTTTCCAGTTATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-541s1c1
Sequence:CCGGGAAGAAAGTTTGGGAGGGATACTCGAGTATCCCTCCCAAACTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-749s1c1
Sequence:CCGGACTCTAATCATGGCTCTGCATCTCGAGATGCAGAGCCATGATTAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013384.3-1165s1c1
Sequence:CCGGCCTCAATAACAACCATCGTAACTCGAGTTACGATGGTTGTTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013384.3-586s1c1
Sequence:CCGGCCAGTATTGGTACTACATGATCTCGAGATCATGTAGTACCAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022075
VALIDATED
CERS2 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1549s21c1
Sequence:CCGGCTGCGCTATAGGGTCACTTTACTCGAGTAAAGTGACCCTATAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-587s21c1
Sequence:CCGGCAACGCCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022075.3-798s21c1
Sequence:CCGGATGGCCGTCATTGTGGATAAACTCGAGTTTATCCACAATGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1084s21c1
Sequence:CCGGTGGAGTCAGCCAAGATGTTTACTCGAGTAAACATCTTGGCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1236s21c1
Sequence:CCGGCCTGCCTTCTTTGGCTATTACCTCGAGGTAATAGCCAAAGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022075
VALIDATED
CERS2 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1549s21c1
Sequence:CCGGCTGCGCTATAGGGTCACTTTACTCGAGTAAAGTGACCCTATAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-587s21c1
Sequence:CCGGCAACGCCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022075.3-798s21c1
Sequence:CCGGATGGCCGTCATTGTGGATAAACTCGAGTTTATCCACAATGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1084s21c1
Sequence:CCGGTGGAGTCAGCCAAGATGTTTACTCGAGTAAACATCTTGGCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1236s21c1
Sequence:CCGGCCTGCCTTCTTTGGCTATTACCTCGAGGTAATAGCCAAAGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022075
VALIDATED
CERS2 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1549s21c1
Sequence:CCGGCTGCGCTATAGGGTCACTTTACTCGAGTAAAGTGACCCTATAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-587s21c1
Sequence:CCGGCAACGCCACCTTGGAACATTTCTCGAGAAATGTTCCAAGGTGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022075.3-798s21c1
Sequence:CCGGATGGCCGTCATTGTGGATAAACTCGAGTTTATCCACAATGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1084s21c1
Sequence:CCGGTGGAGTCAGCCAAGATGTTTACTCGAGTAAACATCTTGGCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022075.3-1236s21c1
Sequence:CCGGCCTGCCTTCTTTGGCTATTACCTCGAGGTAATAGCCAAAGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks