EMAIL THIS PAGE TO A FRIEND

CERS3

ceramide synthase 3

95 Gene Product Result for
Synonyms: ARCI9 LASS3
UniProtKB ID: Q8IU89, Q8NE64, Q8NEN6
Gene ID:
Mouse(545975) ceramide synthase 3
Rat(499174) ceramide synthase 3
chicken(426648) ceramide synthase 3
domestic cat(101099301) ceramide synthase 3
cow(614354) ceramide synthase 3
dog(607925) ceramide synthase 3
sheep(101110093) ceramide synthase 3
naked mole-rat(101702770) ceramide synthase 3
domestic guinea pig(100712857) ceramide synthase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_620510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_620510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_620510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178842 Rosetta Predictions human pricing
NM_001127561 Rosetta Predictions rat pricing
XM_620510 Rosetta Predictions mouse pricing
XM_907730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117448 predicted 653
2 SASI_Hs01_00117449 predicted 693
3 SASI_Hs01_00117450 predicted 757
4 SASI_Hs01_00117451 predicted 909
5 SASI_Hs01_00117453 predicted 861
6 SASI_Hs01_00117454 predicted 765
7 SASI_Hs02_00369893 predicted 1789
8 SASI_Hs01_00117455 predicted 1063
9 SASI_Hs01_00117456 predicted 600
10 SASI_Hs01_00117457 predicted 995
11 SASI_Hs01_00117452 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254363 predicted 798
2 SASI_Rn02_00254364 predicted 496
3 SASI_Rn02_00254365 predicted 356
4 SASI_Rn02_00254366 predicted 629
5 SASI_Rn02_00254367 predicted 212
6 SASI_Rn02_00254368 predicted 325
7 SASI_Rn02_00254369 predicted 669
8 SASI_Rn02_00254370 predicted 434
9 SASI_Rn02_00254371 predicted 289
10 SASI_Rn02_00254372 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229487 predicted 940
2 SASI_Mm01_00229488 predicted 937
3 SASI_Mm01_00229489 predicted 944
4 SASI_Mm01_00229490 predicted 1029
5 SASI_Mm01_00229491 predicted 937
6 SASI_Mm01_00229492 predicted 941
7 SASI_Mm01_00229493 predicted 937
8 SASI_Mm01_00229494 predicted 940
9 SASI_Mm01_00229495 predicted 980
10 SASI_Mm01_00229496 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433509 predicted 946
2 SASI_Mm02_00433510 predicted 418
3 SASI_Mm02_00433511 predicted 1022
4 SASI_Mm02_00433512 predicted 278
5 SASI_Mm02_00433513 predicted 518
6 SASI_Mm02_00433514 predicted 884
7 SASI_Mm02_00433515 predicted 547
8 SASI_Mm02_00433516 predicted 346
9 SASI_Mm02_00433517 predicted 209
10 SASI_Mm02_00433518 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178842
CERS3 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-1439s21c1
Sequence:CCGGAGGAGTGATGACGAGGATTATCTCGAGATAATCCTCGTCATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-571s21c1
Sequence:CCGGGCTGATTATCAGACGTGTATTCTCGAGAATACACGTCTGATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-573s1c1
Sequence:CCGGGCTGATTATCAGGCGTGTATTCTCGAGAATACACGCCTGATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1502s1c1
Sequence:CCGGGCAAAGAGATGGATTGTTTAACTCGAGTTAAACAATCCATCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1085s1c1
Sequence:CCGGGCTTCTCTTGGTGTGCTAATTCTCGAGAATTAGCACACCAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-661s1c1
Sequence:CCGGCCAAATACTGTCTTAGAGAATCTCGAGATTCTCTAAGACAGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1198s1c1
Sequence:CCGGCAGACCTGTAACACCCTGTTTCTCGAGAAACAGGGTGTTACAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178842
CERS3 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-1439s21c1
Sequence:CCGGAGGAGTGATGACGAGGATTATCTCGAGATAATCCTCGTCATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-571s21c1
Sequence:CCGGGCTGATTATCAGACGTGTATTCTCGAGAATACACGTCTGATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-573s1c1
Sequence:CCGGGCTGATTATCAGGCGTGTATTCTCGAGAATACACGCCTGATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1502s1c1
Sequence:CCGGGCAAAGAGATGGATTGTTTAACTCGAGTTAAACAATCCATCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1085s1c1
Sequence:CCGGGCTTCTCTTGGTGTGCTAATTCTCGAGAATTAGCACACCAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-661s1c1
Sequence:CCGGCCAAATACTGTCTTAGAGAATCTCGAGATTCTCTAAGACAGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1198s1c1
Sequence:CCGGCAGACCTGTAACACCCTGTTTCTCGAGAAACAGGGTGTTACAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178842
CERS3 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-1439s21c1
Sequence:CCGGAGGAGTGATGACGAGGATTATCTCGAGATAATCCTCGTCATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178842.3-571s21c1
Sequence:CCGGGCTGATTATCAGACGTGTATTCTCGAGAATACACGTCTGATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-573s1c1
Sequence:CCGGGCTGATTATCAGGCGTGTATTCTCGAGAATACACGCCTGATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1502s1c1
Sequence:CCGGGCAAAGAGATGGATTGTTTAACTCGAGTTAAACAATCCATCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1085s1c1
Sequence:CCGGGCTTCTCTTGGTGTGCTAATTCTCGAGAATTAGCACACCAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-661s1c1
Sequence:CCGGCCAAATACTGTCTTAGAGAATCTCGAGATTCTCTAAGACAGTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178842.2-1198s1c1
Sequence:CCGGCAGACCTGTAACACCCTGTTTCTCGAGAAACAGGGTGTTACAGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_620510
CERS3 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1221s21c1
Sequence:GTACCGGGATGCTCAACAGATGCATATTCTCGAGAATATGCATCTGTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-442s21c1
Sequence:GTACCGGGCAAATGCACTTGGCATTAAACTCGAGTTTAATGCCAAGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1061s21c1
Sequence:CCGGTCTTCATTAGCCGATTCATTACTCGAGTAATGAATCGGCTAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-647s21c1
Sequence:CCGGAGGAGTCTTGCTGGCGATTTACTCGAGTAAATCGCCAGCAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-348s21c1
Sequence:CCGGCGTGAAAGCTTCCCACTTATACTCGAGTATAAGTGGGAAGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_620510
CERS3 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1221s21c1
Sequence:GTACCGGGATGCTCAACAGATGCATATTCTCGAGAATATGCATCTGTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-442s21c1
Sequence:GTACCGGGCAAATGCACTTGGCATTAAACTCGAGTTTAATGCCAAGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1061s21c1
Sequence:CCGGTCTTCATTAGCCGATTCATTACTCGAGTAATGAATCGGCTAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-647s21c1
Sequence:CCGGAGGAGTCTTGCTGGCGATTTACTCGAGTAAATCGCCAGCAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-348s21c1
Sequence:CCGGCGTGAAAGCTTCCCACTTATACTCGAGTATAAGTGGGAAGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_620510
CERS3 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1221s21c1
Sequence:GTACCGGGATGCTCAACAGATGCATATTCTCGAGAATATGCATCTGTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-442s21c1
Sequence:GTACCGGGCAAATGCACTTGGCATTAAACTCGAGTTTAATGCCAAGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-1061s21c1
Sequence:CCGGTCTTCATTAGCCGATTCATTACTCGAGTAATGAATCGGCTAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-647s21c1
Sequence:CCGGAGGAGTCTTGCTGGCGATTTACTCGAGTAAATCGCCAGCAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_620510.3-348s21c1
Sequence:CCGGCGTGAAAGCTTCCCACTTATACTCGAGTATAAGTGGGAAGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks