EMAIL THIS PAGE TO A FRIEND

CERS4

ceramide synthase 4

74 Gene Product Result for
Synonyms: LASS4 Trh1
UniProtKB ID: Q9HA82, D6W665
Gene ID:
Mouse(67260) ceramide synthase 4
Rat(304208) ceramide synthase 4
cow(505233) ceramide synthase 4
domestic cat(101093918) ceramide synthase 4
dog(485008) ceramide synthase 4
domestic guinea pig(100713142) ceramide synthase 4
naked mole-rat(101715336) ceramide synthase 4
sheep(101102559) ceramide synthase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA054729 Anti-CERS4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4301210 Anti-CERS4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV36036 Anti-LASS4 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, mouse, canine, bovine, rat, pig
western blot pricing
AV37354 Anti-LASS4 antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, rat
western blot pricing
SAB4503164 Anti-LASS4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB2103414 Anti-LASS4, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, human, mouse, horse, pig, rat
western blot pricing
WH0079603M1 Monoclonal Anti-LASS4 antibody produced in mouse clone 7D1, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1405267 Monoclonal Anti-LASS4 antibody produced in mouse clone 7D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409812 Monoclonal Anti-LASS4 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409813 Monoclonal Anti-LASS4 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409814 Monoclonal Anti-LASS4 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029281 MISSION® esiRNA esiRNA targeting mouse Lass4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024552 Rosetta Predictions human pricing
NM_001107117 Rosetta Predictions rat pricing
NM_026058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093178 predicted 979
2 SASI_Hs01_00093179 predicted 833
3 SASI_Hs01_00093180 predicted 947
4 SASI_Hs01_00093181 predicted 774
5 SASI_Hs01_00093182 predicted 1287
6 SASI_Hs01_00093183 predicted 792
7 SASI_Hs01_00093184 predicted 1252
8 SASI_Hs01_00093185 predicted 1031
9 SASI_Hs01_00093186 predicted 813
10 SASI_Hs01_00093187 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225666 predicted 1029
2 SASI_Rn02_00225667 predicted 1041
3 SASI_Rn02_00225668 predicted 776
4 SASI_Rn02_00225669 predicted 694
5 SASI_Rn02_00225670 predicted 669
6 SASI_Rn02_00225671 predicted 760
7 SASI_Rn02_00225672 predicted 742
8 SASI_Rn02_00225673 predicted 1079
9 SASI_Rn02_00225674 predicted 632
10 SASI_Rn02_00225675 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329587 predicted 836
2 SASI_Mm02_00329588 predicted 341
3 SASI_Mm02_00329589 predicted 928
4 SASI_Mm02_00329590 predicted 702
5 SASI_Mm02_00329591 predicted 1165
6 SASI_Mm02_00329592 predicted 690
7 SASI_Mm02_00329593 predicted 1170
8 SASI_Mm02_00329594 predicted 1027
9 SASI_Mm02_00329595 predicted 1457
10 SASI_Mm02_00329596 predicted 1081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024552
CERS4 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-991s1c1
Sequence:CCGGGTTACATGATTCCTCTGACTACTCGAGTAGTCAGAGGAATCATGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1138s1c1
Sequence:CCGGCACCACATACTACGAGTCCATCTCGAGATGGACTCGTAGTATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-439s1c1
Sequence:CCGGCCTTGCCTTTGAGAGATTCATCTCGAGATGAATCTCTCAAAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1289s1c1
Sequence:CCGGGAGAAGGACATTCGTAGTGATCTCGAGATCACTACGAATGTCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1063s1c1
Sequence:CCGGCGACGCTCTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAGAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024552
CERS4 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-991s1c1
Sequence:CCGGGTTACATGATTCCTCTGACTACTCGAGTAGTCAGAGGAATCATGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1138s1c1
Sequence:CCGGCACCACATACTACGAGTCCATCTCGAGATGGACTCGTAGTATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-439s1c1
Sequence:CCGGCCTTGCCTTTGAGAGATTCATCTCGAGATGAATCTCTCAAAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1289s1c1
Sequence:CCGGGAGAAGGACATTCGTAGTGATCTCGAGATCACTACGAATGTCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1063s1c1
Sequence:CCGGCGACGCTCTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAGAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024552
CERS4 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-991s1c1
Sequence:CCGGGTTACATGATTCCTCTGACTACTCGAGTAGTCAGAGGAATCATGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1138s1c1
Sequence:CCGGCACCACATACTACGAGTCCATCTCGAGATGGACTCGTAGTATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-439s1c1
Sequence:CCGGCCTTGCCTTTGAGAGATTCATCTCGAGATGAATCTCTCAAAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1289s1c1
Sequence:CCGGGAGAAGGACATTCGTAGTGATCTCGAGATCACTACGAATGTCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024552.1-1063s1c1
Sequence:CCGGCGACGCTCTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAGAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026058
CERS4 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026058.2-1998s1c1
Sequence:CCGGCCAGTATTACTTAACGCAGAACTCGAGTTCTGCGTTAAGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-681s1c1
Sequence:CCGGGCCCTTTGATGTCAAACGCAACTCGAGTTGCGTTTGACATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-1023s1c1
Sequence:CCGGGCTACAGATTCTTCATGTGTACTCGAGTACACATGAAGAATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-246s1c1
Sequence:CCGGGCGAATTGTCTTTGAGAGATTCTCGAGAATCTCTCAAAGACAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-787s1c1
Sequence:CCGGGCTGTGGTACTGTTGTTGCATCTCGAGATGCAACAACAGTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-662s21c1
Sequence:CCGGTGGTTGTGGTCGCCATCATTGCTCGAGCAATGATGGCGACCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-917s21c1
Sequence:CCGGTACCTGCTGGAGGGTTGTAAGCTCGAGCTTACAACCCTCCAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026058.4-1395s21c1
Sequence:CCGGTTGCCGCCAGCATTGTGAATACTCGAGTATTCACAATGCTGGCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-758s21c1
Sequence:CCGGCTTTCACTGCTGATCACTTTGCTCGAGCAAAGTGATCAGCAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-1002s21c1
Sequence:CCGGTCTTCTACACGCGCCTCATATCTCGAGATATGAGGCGCGTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026058
CERS4 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026058.2-1998s1c1
Sequence:CCGGCCAGTATTACTTAACGCAGAACTCGAGTTCTGCGTTAAGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-681s1c1
Sequence:CCGGGCCCTTTGATGTCAAACGCAACTCGAGTTGCGTTTGACATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-1023s1c1
Sequence:CCGGGCTACAGATTCTTCATGTGTACTCGAGTACACATGAAGAATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-246s1c1
Sequence:CCGGGCGAATTGTCTTTGAGAGATTCTCGAGAATCTCTCAAAGACAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-787s1c1
Sequence:CCGGGCTGTGGTACTGTTGTTGCATCTCGAGATGCAACAACAGTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-662s21c1
Sequence:CCGGTGGTTGTGGTCGCCATCATTGCTCGAGCAATGATGGCGACCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-917s21c1
Sequence:CCGGTACCTGCTGGAGGGTTGTAAGCTCGAGCTTACAACCCTCCAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026058.4-1395s21c1
Sequence:CCGGTTGCCGCCAGCATTGTGAATACTCGAGTATTCACAATGCTGGCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-758s21c1
Sequence:CCGGCTTTCACTGCTGATCACTTTGCTCGAGCAAAGTGATCAGCAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-1002s21c1
Sequence:CCGGTCTTCTACACGCGCCTCATATCTCGAGATATGAGGCGCGTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026058
CERS4 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026058.2-1998s1c1
Sequence:CCGGCCAGTATTACTTAACGCAGAACTCGAGTTCTGCGTTAAGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-681s1c1
Sequence:CCGGGCCCTTTGATGTCAAACGCAACTCGAGTTGCGTTTGACATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-1023s1c1
Sequence:CCGGGCTACAGATTCTTCATGTGTACTCGAGTACACATGAAGAATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-246s1c1
Sequence:CCGGGCGAATTGTCTTTGAGAGATTCTCGAGAATCTCTCAAAGACAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026058.2-787s1c1
Sequence:CCGGGCTGTGGTACTGTTGTTGCATCTCGAGATGCAACAACAGTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-662s21c1
Sequence:CCGGTGGTTGTGGTCGCCATCATTGCTCGAGCAATGATGGCGACCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-917s21c1
Sequence:CCGGTACCTGCTGGAGGGTTGTAAGCTCGAGCTTACAACCCTCCAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026058.4-1395s21c1
Sequence:CCGGTTGCCGCCAGCATTGTGAATACTCGAGTATTCACAATGCTGGCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-758s21c1
Sequence:CCGGCTTTCACTGCTGATCACTTTGCTCGAGCAAAGTGATCAGCAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026058.4-1002s21c1
Sequence:CCGGTCTTCTACACGCGCCTCATATCTCGAGATATGAGGCGCGTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks