EMAIL THIS PAGE TO A FRIEND

CERS5

ceramide synthase 5

97 Gene Product Result for
Synonyms: LASS5 Trh4
UniProtKB ID: Q8N5B7
Gene ID:
Mouse(71949) ceramide synthase 5
Rat(366984) ceramide synthase 5
Zebrafish(323020) ceramide synthase 5
cow(530776) ceramide synthase 5
domestic cat(101087243) ceramide synthase 5
dog(477611) ceramide synthase 5
chicken(426879) ceramide synthase 5
sheep(101117661) ceramide synthase 5
naked mole-rat(101701089) ceramide synthase 5
domestic guinea pig(100713687) ceramide synthase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147190 Rosetta Predictions human pricing
NM_001108993 Rosetta Predictions rat pricing
NM_028015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037919 predicted 559
2 SASI_Hs01_00037920 predicted 255
3 SASI_Hs01_00037921 predicted 739
4 SASI_Hs01_00037922 predicted 997
5 SASI_Hs01_00037923 predicted 1220
6 SASI_Hs01_00037924 predicted 734
7 SASI_Hs01_00037925 predicted 477
8 SASI_Hs01_00037926 predicted 205
9 SASI_Hs01_00037927 predicted 1190
10 SASI_Hs01_00037928 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244114 predicted 676
2 SASI_Rn02_00244115 predicted 1105
3 SASI_Rn02_00244116 predicted 765
4 SASI_Rn02_00244117 predicted 544
5 SASI_Rn02_00244118 predicted 330
6 SASI_Rn02_00244119 predicted 934
7 SASI_Rn02_00244120 predicted 689
8 SASI_Rn02_00244121 predicted 679
9 SASI_Rn02_00244122 predicted 1577
10 SASI_Rn02_00244123 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333131 predicted 983
2 SASI_Mm01_00040430 predicted 717
3 SASI_Mm01_00040431 predicted 375
4 SASI_Mm01_00040432 predicted 764
5 SASI_Mm01_00040433 predicted 1364
6 SASI_Mm01_00040434 predicted 910
7 SASI_Mm01_00040435 predicted 691
8 SASI_Mm02_00333132 predicted 1357
9 SASI_Mm01_00040436 predicted 801
10 SASI_Mm01_00040439 predicted 810
11 SASI_Mm01_00040437 predicted 784
12 SASI_Mm01_00040438 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147190
CERS5 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147190.2-862s21c1
Sequence:CCGGTTACACGACTAGGAATCTATCCTCGAGGATAGATTCCTAGTCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-395s1c1
Sequence:CCGGGCTGGATTGGAATGTCCGAAACTCGAGTTTCGGACATTCCAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-236s1c1
Sequence:CCGGGCTGCTCTTCGAGCGATTTATCTCGAGATAAATCGCTCGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-954s1c1
Sequence:CCGGTGGGAGATAATCGGGCCTTATCTCGAGATAAGGCCCGATTATCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-607s1c1
Sequence:CCGGGTGGGCTTTATCACTATTATACTCGAGTATAATAGTGATAAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-819s1c1
Sequence:CCGGGCAGCCAAACTGGCCAATTATCTCGAGATAATTGGCCAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147190
CERS5 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147190.2-862s21c1
Sequence:CCGGTTACACGACTAGGAATCTATCCTCGAGGATAGATTCCTAGTCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-395s1c1
Sequence:CCGGGCTGGATTGGAATGTCCGAAACTCGAGTTTCGGACATTCCAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-236s1c1
Sequence:CCGGGCTGCTCTTCGAGCGATTTATCTCGAGATAAATCGCTCGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-954s1c1
Sequence:CCGGTGGGAGATAATCGGGCCTTATCTCGAGATAAGGCCCGATTATCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-607s1c1
Sequence:CCGGGTGGGCTTTATCACTATTATACTCGAGTATAATAGTGATAAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-819s1c1
Sequence:CCGGGCAGCCAAACTGGCCAATTATCTCGAGATAATTGGCCAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147190
CERS5 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147190.2-862s21c1
Sequence:CCGGTTACACGACTAGGAATCTATCCTCGAGGATAGATTCCTAGTCGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-395s1c1
Sequence:CCGGGCTGGATTGGAATGTCCGAAACTCGAGTTTCGGACATTCCAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-236s1c1
Sequence:CCGGGCTGCTCTTCGAGCGATTTATCTCGAGATAAATCGCTCGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-954s1c1
Sequence:CCGGTGGGAGATAATCGGGCCTTATCTCGAGATAAGGCCCGATTATCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-607s1c1
Sequence:CCGGGTGGGCTTTATCACTATTATACTCGAGTATAATAGTGATAAAGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147190.1-819s1c1
Sequence:CCGGGCAGCCAAACTGGCCAATTATCTCGAGATAATTGGCCAGTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028015
VALIDATED
CERS5 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028015.2-1863s21c1
Sequence:CCGGACATACCCTGCTGCTTATTTACTCGAGTAAATAAGCAGCAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-423s21c1
Sequence:CCGGTCGTATCTGTTACTAAGTATCCTCGAGGATACTTAGTAACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-319s21c1
Sequence:CCGGGATGCTGTTTGAGCGATTTATCTCGAGATAAATCGCTCAAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-567s21c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-538s21c1
Sequence:CCGGGCCTCCAACGCTCACGAAATTCTCGAGAATTTCGTGAGCGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-567s1c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028015.2-1318s1c1
Sequence:CCGGGACTTGTAAAGCCACTGGCAACTCGAGTTGCCAGTGGCTTTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028015.2-1869s1c1
Sequence:CCGGCCTGCTGCTTATTTAATGGTACTCGAGTACCATTAAATAAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-598s1c2
Sequence:CCGGCTTCTGCTACGGAATCAGATTCTCGAGAATCTGATTCCGTAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028015
VALIDATED
CERS5 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028015.2-1863s21c1
Sequence:CCGGACATACCCTGCTGCTTATTTACTCGAGTAAATAAGCAGCAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-423s21c1
Sequence:CCGGTCGTATCTGTTACTAAGTATCCTCGAGGATACTTAGTAACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-319s21c1
Sequence:CCGGGATGCTGTTTGAGCGATTTATCTCGAGATAAATCGCTCAAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-567s21c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-538s21c1
Sequence:CCGGGCCTCCAACGCTCACGAAATTCTCGAGAATTTCGTGAGCGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-567s1c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028015.2-1318s1c1
Sequence:CCGGGACTTGTAAAGCCACTGGCAACTCGAGTTGCCAGTGGCTTTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028015.2-1869s1c1
Sequence:CCGGCCTGCTGCTTATTTAATGGTACTCGAGTACCATTAAATAAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-598s1c2
Sequence:CCGGCTTCTGCTACGGAATCAGATTCTCGAGAATCTGATTCCGTAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028015
VALIDATED
CERS5 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028015.2-1863s21c1
Sequence:CCGGACATACCCTGCTGCTTATTTACTCGAGTAAATAAGCAGCAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-423s21c1
Sequence:CCGGTCGTATCTGTTACTAAGTATCCTCGAGGATACTTAGTAACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-319s21c1
Sequence:CCGGGATGCTGTTTGAGCGATTTATCTCGAGATAAATCGCTCAAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028015.2-567s21c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028015.2-538s21c1
Sequence:CCGGGCCTCCAACGCTCACGAAATTCTCGAGAATTTCGTGAGCGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-567s1c1
Sequence:CCGGGCATGTGGAGATTCACTTATTCTCGAGAATAAGTGAATCTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028015.2-1318s1c1
Sequence:CCGGGACTTGTAAAGCCACTGGCAACTCGAGTTGCCAGTGGCTTTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028015.2-1869s1c1
Sequence:CCGGCCTGCTGCTTATTTAATGGTACTCGAGTACCATTAAATAAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028015.2-598s1c2
Sequence:CCGGCTTCTGCTACGGAATCAGATTCTCGAGAATCTGATTCCGTAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks