EMAIL THIS PAGE TO A FRIEND

CERS6

ceramide synthase 6

200 Gene Product Result for
Synonyms: CERS5 LASS6
UniProtKB ID: Q6ZMG9, Q32M63, Q8N617
Gene ID:
Mouse(241447) ceramide synthase 6
Rat(366065) ceramide synthase 6
domestic guinea pig(100713053) ceramide synthase 6
naked mole-rat(101713278) ceramide synthase 6
sheep(101122252) ceramide synthase 6
Zebrafish(564867) ceramide synthase 6
cow(616901) ceramide synthase 6
domestic cat(101084386) ceramide synthase 6
dog(488387) ceramide synthase 6
chicken(771503) ceramide synthase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203463 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156551 MISSION® esiRNA esiRNA human LASS6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203463 Rosetta Predictions human pricing
XM_001058317 Rosetta Predictions rat pricing
XM_345363 Rosetta Predictions rat pricing
NM_172856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204321 predicted 646
2 SASI_Hs01_00204322 predicted 899
3 SASI_Hs01_00204323 predicted 632
4 SASI_Hs02_00373392 predicted 1304
5 SASI_Hs01_00204324 predicted 340
6 SASI_Hs01_00204325 predicted 1299
7 SASI_Hs01_00204326 predicted 951
8 SASI_Hs01_00204327 predicted 704
9 SASI_Hs01_00204328 predicted 551
10 SASI_Hs01_00204329 predicted 724
11 SASI_Hs01_00204330 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289278 predicted 1041
2 SASI_Rn02_00289279 predicted 1495
3 SASI_Rn02_00289280 predicted 1172
4 SASI_Rn02_00289281 predicted 1614
5 SASI_Rn02_00289282 predicted 1256
6 SASI_Rn02_00289283 predicted 660
7 SASI_Rn02_00289284 predicted 1571
8 SASI_Rn02_00289285 predicted 1270
9 SASI_Rn02_00289286 predicted 1532
10 SASI_Rn02_00289287 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398267 predicted 975
2 SASI_Rn02_00398268 predicted 1096
3 SASI_Rn02_00398269 predicted 315
4 SASI_Rn02_00398270 predicted 674
5 SASI_Rn02_00398271 predicted 685
6 SASI_Rn02_00398272 predicted 1005
7 SASI_Rn02_00398273 predicted 1084
8 SASI_Rn02_00398274 predicted 861
9 SASI_Rn02_00398275 predicted 703
10 SASI_Rn02_00398276 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162397 predicted 1100
2 SASI_Mm01_00162398 predicted 1214
3 SASI_Mm01_00162399 predicted 230
4 SASI_Mm01_00162400 predicted 1182
5 SASI_Mm01_00162401 predicted 309
6 SASI_Mm01_00162402 predicted 1219
7 SASI_Mm01_00162403 predicted 692
8 SASI_Mm01_00162404 predicted 901
9 SASI_Mm01_00162405 predicted 1147
10 SASI_Mm01_00162406 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172856
VALIDATED
CERS6 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172856.1-2643s1c1
Sequence:CCGGCGTGAGTCAAACATCTCCTAACTCGAGTTAGGAGATGTTTGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-345s1c1
Sequence:CCGGGCTATAACAAAGCATCCTGATCTCGAGATCAGGATGCTTTGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-572s1c1
Sequence:CCGGCTGCTGGTATAACTACCCTTACTCGAGTAAGGGTAGTTATACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1004s1c1
Sequence:CCGGCTTGTTACTACAAGGGTTGAACTCGAGTTCAACCCTTGTAGTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1001s1c1
Sequence:CCGGGCTCTTGTTACTACAAGGGTTCTCGAGAACCCTTGTAGTAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-604s21c1
Sequence:CCGGAGCTGACCTTCACTACTATTACTCGAGTAATAGTAGTGAAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-896s21c1
Sequence:CCGGACCACACGGCTGGGCATATTTCTCGAGAAATATGCCCAGCCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172856.3-1537s21c1
Sequence:CCGGCATTCTCTGGGCTCGTGATTGCTCGAGCAATCACGAGCCCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-707s21c1
Sequence:CCGGCTGCACCACCTTGCAACAATTCTCGAGAATTGTTGCAAGGTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-418s21c1
Sequence:CCGGTCAACGCTGGTTTCGACAAAGCTCGAGCTTTGTCGAAACCAGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172856
VALIDATED
CERS6 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172856.1-2643s1c1
Sequence:CCGGCGTGAGTCAAACATCTCCTAACTCGAGTTAGGAGATGTTTGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-345s1c1
Sequence:CCGGGCTATAACAAAGCATCCTGATCTCGAGATCAGGATGCTTTGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-572s1c1
Sequence:CCGGCTGCTGGTATAACTACCCTTACTCGAGTAAGGGTAGTTATACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1004s1c1
Sequence:CCGGCTTGTTACTACAAGGGTTGAACTCGAGTTCAACCCTTGTAGTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1001s1c1
Sequence:CCGGGCTCTTGTTACTACAAGGGTTCTCGAGAACCCTTGTAGTAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-604s21c1
Sequence:CCGGAGCTGACCTTCACTACTATTACTCGAGTAATAGTAGTGAAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-896s21c1
Sequence:CCGGACCACACGGCTGGGCATATTTCTCGAGAAATATGCCCAGCCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172856.3-1537s21c1
Sequence:CCGGCATTCTCTGGGCTCGTGATTGCTCGAGCAATCACGAGCCCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-707s21c1
Sequence:CCGGCTGCACCACCTTGCAACAATTCTCGAGAATTGTTGCAAGGTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-418s21c1
Sequence:CCGGTCAACGCTGGTTTCGACAAAGCTCGAGCTTTGTCGAAACCAGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172856
VALIDATED
CERS6 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172856.1-2643s1c1
Sequence:CCGGCGTGAGTCAAACATCTCCTAACTCGAGTTAGGAGATGTTTGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-345s1c1
Sequence:CCGGGCTATAACAAAGCATCCTGATCTCGAGATCAGGATGCTTTGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-572s1c1
Sequence:CCGGCTGCTGGTATAACTACCCTTACTCGAGTAAGGGTAGTTATACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1004s1c1
Sequence:CCGGCTTGTTACTACAAGGGTTGAACTCGAGTTCAACCCTTGTAGTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172856.1-1001s1c1
Sequence:CCGGGCTCTTGTTACTACAAGGGTTCTCGAGAACCCTTGTAGTAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-604s21c1
Sequence:CCGGAGCTGACCTTCACTACTATTACTCGAGTAATAGTAGTGAAGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-896s21c1
Sequence:CCGGACCACACGGCTGGGCATATTTCTCGAGAAATATGCCCAGCCGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172856.3-1537s21c1
Sequence:CCGGCATTCTCTGGGCTCGTGATTGCTCGAGCAATCACGAGCCCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-707s21c1
Sequence:CCGGCTGCACCACCTTGCAACAATTCTCGAGAATTGTTGCAAGGTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172856.3-418s21c1
Sequence:CCGGTCAACGCTGGTTTCGACAAAGCTCGAGCTTTGTCGAAACCAGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203463
VALIDATED
CERS6 MISSION shRNA Bacterial Glycerol Stock
ceramide synthase 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-281s1c1
Sequence:CCGGCTCATCTTCGAGAGATTTGTACTCGAGTACAAATCTCTCGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1805s1c1
Sequence:CCGGCGGACGAACTAGGTGTTTAATCTCGAGATTAAACACCTAGTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203463.1-910s1c1
Sequence:CCGGCCTGTTTGTTATGTTTGCCGTCTCGAGACGGCAAACATAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-1045s1c1
Sequence:CCGGGCTATTGCTAGTACAAGGGTTCTCGAGAACCCTTGTACTAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1066s1c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-650s21c1
Sequence:CCGGACTGACCTTCACTACTATTACCTCGAGGTAATAGTAGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1298s21c1
Sequence:CCGGCCCAAGCAAAGTGAACTATTTCTCGAGAAATAGTTCACTTTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-941s21c1
Sequence:CCGGACCACACGACTGGGTATATTTCTCGAGAAATATACCCAGTCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-278s21c1
Sequence:CCGGCGGCTCATCTTCGAGAGATTTCTCGAGAAATCTCTCGAAGATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1066s21c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203463
VALIDATED
CERS6 MISSION shRNA shRNA Plasmid DNA
ceramide synthase 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-281s1c1
Sequence:CCGGCTCATCTTCGAGAGATTTGTACTCGAGTACAAATCTCTCGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1805s1c1
Sequence:CCGGCGGACGAACTAGGTGTTTAATCTCGAGATTAAACACCTAGTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203463.1-910s1c1
Sequence:CCGGCCTGTTTGTTATGTTTGCCGTCTCGAGACGGCAAACATAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-1045s1c1
Sequence:CCGGGCTATTGCTAGTACAAGGGTTCTCGAGAACCCTTGTACTAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1066s1c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-650s21c1
Sequence:CCGGACTGACCTTCACTACTATTACCTCGAGGTAATAGTAGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1298s21c1
Sequence:CCGGCCCAAGCAAAGTGAACTATTTCTCGAGAAATAGTTCACTTTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-941s21c1
Sequence:CCGGACCACACGACTGGGTATATTTCTCGAGAAATATACCCAGTCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-278s21c1
Sequence:CCGGCGGCTCATCTTCGAGAGATTTCTCGAGAAATCTCTCGAAGATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1066s21c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203463
VALIDATED
CERS6 MISSION shRNA Lentiviral Transduction Particles
ceramide synthase 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-281s1c1
Sequence:CCGGCTCATCTTCGAGAGATTTGTACTCGAGTACAAATCTCTCGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1805s1c1
Sequence:CCGGCGGACGAACTAGGTGTTTAATCTCGAGATTAAACACCTAGTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203463.1-910s1c1
Sequence:CCGGCCTGTTTGTTATGTTTGCCGTCTCGAGACGGCAAACATAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203463.1-1045s1c1
Sequence:CCGGGCTATTGCTAGTACAAGGGTTCTCGAGAACCCTTGTACTAGCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_203463.1-1066s1c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-650s21c1
Sequence:CCGGACTGACCTTCACTACTATTACCTCGAGGTAATAGTAGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1298s21c1
Sequence:CCGGCCCAAGCAAAGTGAACTATTTCTCGAGAAATAGTTCACTTTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-941s21c1
Sequence:CCGGACCACACGACTGGGTATATTTCTCGAGAAATATACCCAGTCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203463.1-278s21c1
Sequence:CCGGCGGCTCATCTTCGAGAGATTTCTCGAGAAATCTCTCGAAGATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_203463.1-1066s21c1
Sequence:CCGGGAACTGCTTCTGGTCTTACTTCTCGAGAAGTAAGACCAGAAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks