EMAIL THIS PAGE TO A FRIEND

CES1

carboxylesterase 1

140 Gene Product Result for
Synonyms: ACAT CE-1 CEH CES2 HMSE HMSE1 PCE-1 REH SES1 TGH hCE-1
Gene ID:
Human(1066) Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
chicken(415786) carboxylesterase 1 (monocyte/macrophage serine esterase 1)
cow(512098) carboxylesterase 1 (monocyte/macrophage serine esterase 1)
domestic cat(493774) carboxylesterase 1
dog(403643) carboxylesterase 1
naked mole-rat(101726140) carboxylesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105878 Anti-CES1 (181-194) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105879 Anti-CES1 (401-415) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
AV41877 Anti-CES1 (AB1) antibody produced in rabbit IgG fraction of antiserum human, mouse, rat, rabbit, bovine, canine, rabbit, horse, pig, guinea pig
western blot pricing
AV41878 Anti-CES1 (AB2) antibody produced in rabbit IgG fraction of antiserum human, pig, rat, rabbit, bovine, rabbit, guinea pig, canine, mouse, horse
western blot pricing
SAB2500230 Anti-CES1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405606 Anti-CES1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012023 Anti-CES1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410118 Anti-CES1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA046717 Anti-CES1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C101400 1,2-Cyclohexanedione 97% human pricing
29059 1,3-Cyclohexanedione purum, for fluorescence, ≥97.0% (T) human pricing
C101605 1,3-Cyclohexanedione 97% human pricing
D33454 1,3-Diphenyl-1,3-propanedione 98% human pricing
223034 1-Phenyl-1,2-propanedione 99% human pricing
W322601 1-Phenyl-1,2-propanedione 98%, FG human pricing
630012 2,2′-Dichlorobenzil 97% human pricing
P57409 2,2′-Pyridil 97% human pricing
454389 2,2′-Thenil 98% human pricing
196118 2,2-Dimethoxy-2-phenylacetophenone 99% human pricing
11038 2,3-Butanedione analytical standard human pricing
B85307 2,3-Butanedione 97% human pricing
W254304 2,3-Heptanedione ≥97%, FG human pricing
241962 2,3-Pentanedione 97% human pricing
W284106 2,3-Pentanedione ≥96%, FCC, FG human pricing
W284114 2,3-Pentanedione natural, ≥96%, FG human pricing
542229 2-Chloro-3′,4′-dimethoxybenzil 97% human pricing
68228 2-Decanone analytical standard human pricing
W510637 2-Decanone ≥98% human pricing
196207 2-Decanone 98% human pricing
M37935 2-Methyl-1,3-cyclohexanedione 97% human pricing
117021 2-Methyl-1,3-cyclopentanedione 99% human pricing
381802 3,3′-Dimethoxybenzil 99% human pricing
T6601 3,4,5,6-Tetrachloro-1,2-benzoquinone 97% human pricing
157457 3,5-Di-tert-butyl-o-benzoquinone 98% human pricing
W330507 3-Methyl-1,2-cyclohexanedione ≥98%, FG human pricing
328057 4,4′-Dibromobenzil 90%, technical grade human pricing
381322 4,4′-Difluorobenzil 98% human pricing
159611 4,4′-Dimethoxybenzil 98% human pricing
A88409 4,4′-Dimethoxybenzoin 95% human pricing
146706 4,4′-Dimethylbenzil 97% human pricing
12927 4-Benzoylbenzoic acid purum, ≥98.0% (T) human pricing
B12407 4-Benzoylbenzoic acid 99% human pricing
05581 Acetylacetone analytical standard human pricing
P7754 Acetylacetone ReagentPlus®, ≥99% human pricing
10916 Acetylacetone produced by Wacker Chemie AG, Burghausen, Germany, ≥99.5% (GC) human pricing
B5151 Benzil 98% human pricing
399396 Benzoin purified by sublimation, ≥99.5% human pricing
W213209 Benzoin ≥98% human pricing
B8681 Benzoin 98% human pricing
343528 Benzyl sulfone 99% human pricing
45374 Chloranil PESTANAL®, analytical standard human pricing
PS11 Chloranil analytical standard human pricing
138029 Furil 98% human pricing
192651 Furoin 98% human pricing
12309 p-Benzoquinone for spectrophotometric det. of amines, ≥99.5% (HPLC) human pricing
B10358 p-Benzoquinone reagent grade, ≥98% Green Alternative human pricing
232017 Tetrachloro-1,4-benzoquinone 99% human pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing
277738 Benzophenone-(carbonyl-13C) 99 atom % 13C human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001266 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106751 MISSION® esiRNA esiRNA human CES1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025194 Rosetta Predictions human pricing
NM_001025195 Rosetta Predictions human pricing
NM_001266 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307392 predicted 448
2 SASI_Hs01_00214850 predicted 1575
3 SASI_Hs02_00307393 predicted 402
4 SASI_Hs01_00214851 predicted 1608
5 SASI_Hs01_00214852 predicted 1729
6 SASI_Hs01_00214853 predicted 1578
7 SASI_Hs01_00214855 predicted 1395
8 SASI_Hs02_00307394 predicted 440
9 SASI_Hs01_00214856 predicted 910
10 SASI_Hs02_00307395 predicted 427
11 SASI_Hs01_00214854 predicted 1593
12 SASI_Hs01_00214857 predicted 1436
13 SASI_Hs01_00214858 predicted 1745
14 SASI_Hs01_00214859 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307396 predicted 450
2 SASI_Hs01_00075134 predicted 1581
3 SASI_Hs02_00307397 predicted 399
4 SASI_Hs01_00075135 predicted 1611
5 SASI_Hs01_00075136 predicted 1732
6 SASI_Hs01_00075137 predicted 1575
7 SASI_Hs01_00075139 predicted 1394
8 SASI_Hs02_00307398 predicted 446
9 SASI_Hs01_00075140 predicted 907
10 SASI_Hs02_00307399 predicted 436
11 SASI_Hs01_00075138 predicted 1594
12 SASI_Hs01_00075141 predicted 1447
13 SASI_Hs01_00075142 predicted 1741
14 SASI_Hs01_00075143 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331463 predicted 452
2 SASI_Hs01_00013584 predicted 1576
3 SASI_Hs02_00331464 predicted 399
4 SASI_Hs01_00013585 predicted 1599
5 SASI_Hs01_00013586 predicted 1725
6 SASI_Hs01_00013587 predicted 1569
7 SASI_Hs01_00013589 predicted 1386
8 SASI_Hs02_00331465 predicted 443
9 SASI_Hs01_00013590 predicted 905
10 SASI_Hs02_00331466 predicted 425
11 SASI_Hs01_00013588 predicted 1595
12 SASI_Hs01_00013591 predicted 1431
13 SASI_Hs01_00013592 predicted 1735
14 SASI_Hs01_00013593 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001266
CES1 MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1514s21c1
Sequence:CCGGATGAGCTCTTCTCCGTCTTTGCTCGAGCAAAGACGGAGAAGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1481s21c1
Sequence:CCGGTGAAACCCAAGACGGTGATAGCTCGAGCTATCACCGTCTTGGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-985s21c1
Sequence:CCGGGAGCTCTTGGAGACGACATTGCTCGAGCAATGTCGTCTCCAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1111s1c1
Sequence:CCGGCGGAATTAACAAGCAGGAGTTCTCGAGAACTCCTGCTTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-970s1c1
Sequence:CCGGGAAATTCTTATCTCTGGACTTCTCGAGAAGTCCAGAGATAAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1744s1c1
Sequence:CCGGCCAGACAGAACACATAGAGCTCTCGAGAGCTCTATGTGTTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-437s1c1
Sequence:CCGGCCTGCTGACTTGACCAAGAAACTCGAGTTTCTTGGTCAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1232s1c1
Sequence:CCGGTGCATTGCTAAGGAACTGATTCTCGAGAATCAGTTCCTTAGCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001266
CES1 MISSION shRNA shRNA Plasmid DNA
carboxylesterase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1514s21c1
Sequence:CCGGATGAGCTCTTCTCCGTCTTTGCTCGAGCAAAGACGGAGAAGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1481s21c1
Sequence:CCGGTGAAACCCAAGACGGTGATAGCTCGAGCTATCACCGTCTTGGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-985s21c1
Sequence:CCGGGAGCTCTTGGAGACGACATTGCTCGAGCAATGTCGTCTCCAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1111s1c1
Sequence:CCGGCGGAATTAACAAGCAGGAGTTCTCGAGAACTCCTGCTTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-970s1c1
Sequence:CCGGGAAATTCTTATCTCTGGACTTCTCGAGAAGTCCAGAGATAAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1744s1c1
Sequence:CCGGCCAGACAGAACACATAGAGCTCTCGAGAGCTCTATGTGTTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-437s1c1
Sequence:CCGGCCTGCTGACTTGACCAAGAAACTCGAGTTTCTTGGTCAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1232s1c1
Sequence:CCGGTGCATTGCTAAGGAACTGATTCTCGAGAATCAGTTCCTTAGCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001266
CES1 MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1514s21c1
Sequence:CCGGATGAGCTCTTCTCCGTCTTTGCTCGAGCAAAGACGGAGAAGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-1481s21c1
Sequence:CCGGTGAAACCCAAGACGGTGATAGCTCGAGCTATCACCGTCTTGGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001266.4-985s21c1
Sequence:CCGGGAGCTCTTGGAGACGACATTGCTCGAGCAATGTCGTCTCCAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1111s1c1
Sequence:CCGGCGGAATTAACAAGCAGGAGTTCTCGAGAACTCCTGCTTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-970s1c1
Sequence:CCGGGAAATTCTTATCTCTGGACTTCTCGAGAAGTCCAGAGATAAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1744s1c1
Sequence:CCGGCCAGACAGAACACATAGAGCTCTCGAGAGCTCTATGTGTTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-437s1c1
Sequence:CCGGCCTGCTGACTTGACCAAGAAACTCGAGTTTCTTGGTCAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001266.3-1232s1c1
Sequence:CCGGTGCATTGCTAAGGAACTGATTCTCGAGAATCAGTTCCTTAGCAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks