EMAIL THIS PAGE TO A FRIEND

CES1P1

carboxylesterase 1 pseudogene 1

13 Gene Product Result for
Synonyms: CES1A2 CES1A3 CES4 CESR PCE-3
Species: Human CES1P1(51716)
UniProtKB ID: Q9UKY3, A2RRL8, B9ZVS2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016280 Rosetta Predictions human pricing
NR_003276 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242768 predicted 284
2 SASI_Hs01_00242769 predicted 1310
3 SASI_Hs01_00242770 predicted 1186
4 SASI_Hs01_00242771 predicted 1266
5 SASI_Hs01_00242772 predicted 1310
6 SASI_Hs01_00242773 predicted 1295
7 SASI_Hs01_00242774 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379076 predicted 283
2 SASI_Hs02_00379077 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016280
CES1P1 MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-331s1c1
Sequence:CCGGGCAGTTAATCTCAGAGCTATTCTCGAGAATAGCTCTGAGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-127s1c1
Sequence:CCGGCACCGTGCATGGCAAAGTGTTCTCGAGAACACTTTGCCATGCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-263s1c1
Sequence:CCGGCCGTGGAGCTTTGTGAAGAATCTCGAGATTCTTCACAAAGCTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-296s1c1
Sequence:CCGGCCTCCTATGTTCACCCAAGATCTCGAGATCTTGGGTGAACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-845s1c1
Sequence:CCGGGAGGTAGGTCTCCGGCTGGTACTCGAGTACCAGCCGGAGACCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016280
CES1P1 MISSION shRNA shRNA Plasmid DNA
carboxylesterase 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-331s1c1
Sequence:CCGGGCAGTTAATCTCAGAGCTATTCTCGAGAATAGCTCTGAGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-127s1c1
Sequence:CCGGCACCGTGCATGGCAAAGTGTTCTCGAGAACACTTTGCCATGCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-263s1c1
Sequence:CCGGCCGTGGAGCTTTGTGAAGAATCTCGAGATTCTTCACAAAGCTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-296s1c1
Sequence:CCGGCCTCCTATGTTCACCCAAGATCTCGAGATCTTGGGTGAACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-845s1c1
Sequence:CCGGGAGGTAGGTCTCCGGCTGGTACTCGAGTACCAGCCGGAGACCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016280
CES1P1 MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-331s1c1
Sequence:CCGGGCAGTTAATCTCAGAGCTATTCTCGAGAATAGCTCTGAGATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-127s1c1
Sequence:CCGGCACCGTGCATGGCAAAGTGTTCTCGAGAACACTTTGCCATGCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-263s1c1
Sequence:CCGGCCGTGGAGCTTTGTGAAGAATCTCGAGATTCTTCACAAAGCTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-296s1c1
Sequence:CCGGCCTCCTATGTTCACCCAAGATCTCGAGATCTTGGGTGAACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016280.1-845s1c1
Sequence:CCGGGAGGTAGGTCTCCGGCTGGTACTCGAGTACCAGCCGGAGACCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks