EMAIL THIS PAGE TO A FRIEND

CES1P2

carboxylesterase 1 pseudogene 2

12 Gene Product Result for
Species: Human CES1P2(390732)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372639 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016696 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00491462 predicted 836
2 SASI_Hs02_00491463 predicted 469
3 SASI_Hs02_00491464 predicted 609
4 SASI_Hs02_00491465 predicted 396
5 SASI_Hs02_00491466 predicted 596
6 SASI_Hs02_00491467 predicted 925
7 SASI_Hs02_00491468 predicted 464
8 SASI_Hs02_00491469 predicted 839
9 SASI_Hs02_00491470 predicted 626
10 SASI_Hs02_00491471 predicted 158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372639
CES1P2 MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 1 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-460s1c1
Sequence:CCGGGCTAACACTGTTGGGTGTGAACTCGAGTTCACACCCAACAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-691s1c1
Sequence:CCGGCTTCCAACATTGATGAGCTATCTCGAGATAGCTCATCAATGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-777s1c1
Sequence:CCGGTGTTCGCATTCCTAAGGAATTCTCGAGAATTCCTTAGGAATGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-660s1c1
Sequence:CCGGCGGATTTAACAGGAAGGAATTCTCGAGAATTCCTTCCTGTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-153s1c1
Sequence:CCGGAGAACTATTGACCAACCGAAACTCGAGTTTCGGTTGGTCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372639
CES1P2 MISSION shRNA shRNA Plasmid DNA
carboxylesterase 1 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-460s1c1
Sequence:CCGGGCTAACACTGTTGGGTGTGAACTCGAGTTCACACCCAACAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-691s1c1
Sequence:CCGGCTTCCAACATTGATGAGCTATCTCGAGATAGCTCATCAATGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-777s1c1
Sequence:CCGGTGTTCGCATTCCTAAGGAATTCTCGAGAATTCCTTAGGAATGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-660s1c1
Sequence:CCGGCGGATTTAACAGGAAGGAATTCTCGAGAATTCCTTCCTGTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-153s1c1
Sequence:CCGGAGAACTATTGACCAACCGAAACTCGAGTTTCGGTTGGTCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372639
CES1P2 MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 1 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-460s1c1
Sequence:CCGGGCTAACACTGTTGGGTGTGAACTCGAGTTCACACCCAACAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-691s1c1
Sequence:CCGGCTTCCAACATTGATGAGCTATCTCGAGATAGCTCATCAATGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-777s1c1
Sequence:CCGGTGTTCGCATTCCTAAGGAATTCTCGAGAATTCCTTAGGAATGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-660s1c1
Sequence:CCGGCGGATTTAACAGGAAGGAATTCTCGAGAATTCCTTCCTGTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372639.1-153s1c1
Sequence:CCGGAGAACTATTGACCAACCGAAACTCGAGTTTCGGTTGGTCAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks