EMAIL THIS PAGE TO A FRIEND

CES2

carboxylesterase 2

43 Gene Product Result for
Synonyms: CE-2 CES2A1 PCE-2 iCE
UniProtKB ID: O00748, Q16859, Q5MAB8, Q7Z366, Q8IUP4, Q8TCP8
Gene ID:
Human(8824) Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Rat(100910144) carboxylesterase 2
Zebrafish(566132) carboxylesterase 2 (intestine, liver)
cow(505928) carboxylesterase 2
domestic cat(101096775) carboxylesterase 2
dog(489769) carboxylesterase 2
naked mole-rat(101725754) carboxylesterase 2
domestic guinea pig(100734360) carboxylesterase 2
sheep(101109730) carboxylesterase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003869 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010091 MISSION® esiRNA esiRNA targeting human CES2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003869 Rosetta Predictions human pricing
NM_198061 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336451 predicted 1916
2 SASI_Hs01_00078790 predicted 1621
3 SASI_Hs01_00078792 predicted 1580
4 SASI_Hs02_00336452 predicted 2175
5 SASI_Hs01_00078793 predicted 2240
6 SASI_Hs01_00078794 predicted 1885
7 SASI_Hs01_00078795 predicted 2079
8 SASI_Hs01_00078796 predicted 1386
9 SASI_Hs01_00078797 predicted 1499
10 SASI_Hs01_00078799 predicted 1383
11 SASI_Hs01_00078791 predicted 2083
12 SASI_Hs01_00078798 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371619 predicted 1920
2 SASI_Hs01_00072845 predicted 1617
3 SASI_Hs01_00072847 predicted 1583
4 SASI_Hs02_00371620 predicted 2178
5 SASI_Hs01_00072848 predicted 2245
6 SASI_Hs01_00072849 predicted 1882
7 SASI_Hs01_00072850 predicted 2077
8 SASI_Hs01_00072851 predicted 1382
9 SASI_Hs01_00072852 predicted 1495
10 SASI_Hs01_00072854 predicted 1381
11 SASI_Hs01_00072846 predicted 2088
12 SASI_Hs01_00072853 predicted 2199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003869
VALIDATED
CES2 MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2663s1c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-2197s1c1
Sequence:CCGGCCCTAGCATTGTTGGTGTCAACTCGAGTTGACACCAACAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2485s1c1
Sequence:CCGGCCCTGTGTACTTCTACGAGTTCTCGAGAACTCGTAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-1817s1c1
Sequence:CCGGCAGCAGAATATCGCCCACTTTCTCGAGAAAGTGGGCGATATTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2543s1c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2723s21c1
Sequence:CCGGTTCGACCAGGAGGAGCAATACCTCGAGGTATTGCTCCTCCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2543s21c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2663s21c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2327s21c1
Sequence:CCGGCTGATGTTGCCTCCTACATTTCTCGAGAAATGTAGGAGGCAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003869.4-3179s21c1
Sequence:CCGGTGTGTGATTAGAAGCTAAATACTCGAGTATTTAGCTTCTAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003869
VALIDATED
CES2 MISSION shRNA shRNA Plasmid DNA
carboxylesterase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2663s1c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-2197s1c1
Sequence:CCGGCCCTAGCATTGTTGGTGTCAACTCGAGTTGACACCAACAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2485s1c1
Sequence:CCGGCCCTGTGTACTTCTACGAGTTCTCGAGAACTCGTAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-1817s1c1
Sequence:CCGGCAGCAGAATATCGCCCACTTTCTCGAGAAAGTGGGCGATATTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2543s1c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2723s21c1
Sequence:CCGGTTCGACCAGGAGGAGCAATACCTCGAGGTATTGCTCCTCCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2543s21c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2663s21c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2327s21c1
Sequence:CCGGCTGATGTTGCCTCCTACATTTCTCGAGAAATGTAGGAGGCAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003869.4-3179s21c1
Sequence:CCGGTGTGTGATTAGAAGCTAAATACTCGAGTATTTAGCTTCTAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003869
VALIDATED
CES2 MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2663s1c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-2197s1c1
Sequence:CCGGCCCTAGCATTGTTGGTGTCAACTCGAGTTGACACCAACAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2485s1c1
Sequence:CCGGCCCTGTGTACTTCTACGAGTTCTCGAGAACTCGTAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003869.4-1817s1c1
Sequence:CCGGCAGCAGAATATCGCCCACTTTCTCGAGAAAGTGGGCGATATTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003869.4-2543s1c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2723s21c1
Sequence:CCGGTTCGACCAGGAGGAGCAATACCTCGAGGTATTGCTCCTCCTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2543s21c1
Sequence:CCGGCCGCACATGAAGGCAGACCATCTCGAGATGGTCTGCCTTCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2663s21c1
Sequence:CCGGTGGGCCAACTTTGCGAGAAATCTCGAGATTTCTCGCAAAGTTGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003869.4-2327s21c1
Sequence:CCGGCTGATGTTGCCTCCTACATTTCTCGAGAAATGTAGGAGGCAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003869.4-3179s21c1
Sequence:CCGGTGTGTGATTAGAAGCTAAATACTCGAGTATTTAGCTTCTAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks