EMAIL THIS PAGE TO A FRIEND

CES3

carboxylesterase 3

27 Gene Product Result for
Synonyms: ES31
UniProtKB ID: Q6UWW8, B2Z3W9, F5H242, Q7Z6J1, Q9H6X7
Gene ID:
Human(23491) Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene is expressed in several tissues, particularly in colon, trachea and in brain, and the protein participates in colon and neural drug metabolism. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported, but the biological validity and/or full-length nature of some variants have not been determined.[provided by RefSeq, Jun 2010]
naked mole-rat(101724983) carboxylesterase 3
Zebrafish(560651) carboxylesterase 3
cow(513112) carboxylesterase 3
Horse(100065689) carboxylesterase 3
domestic cat(101097032) carboxylesterase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024922 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024922 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242498 predicted 1294
2 SASI_Hs01_00242499 predicted 389
3 SASI_Hs01_00242500 predicted 246
4 SASI_Hs01_00242501 predicted 1539
5 SASI_Hs01_00242502 predicted 386
6 SASI_Hs01_00242503 predicted 1301
7 SASI_Hs01_00242504 predicted 242
8 SASI_Hs01_00242505 predicted 1162
9 SASI_Hs01_00242506 predicted 1225
10 SASI_Hs01_00242507 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024922
VALIDATED
CES3 MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1237s1c1
Sequence:CCGGGCCCACCGTCATAGATGAATACTCGAGTATTCATCTATGACGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1147s1c1
Sequence:CCGGCCTGGATACAATGGAGCAGATCTCGAGATCTGCTCCATTGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1735s1c1
Sequence:CCGGGATACAACAGTGGCACCAGAACTCGAGTTCTGGTGCCACTGTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-393s1c1
Sequence:CCGGGCAGATTTGTCCTCAACGGAACTCGAGTTCCGTTGAGGACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-233s1c1
Sequence:CCGGGACCGCCTTGTGAATGTCTTTCTCGAGAAAGACATTCACAAGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024922.4-1630s21c1
Sequence:CCGGATTCAACCAGGCGGAACAATACTCGAGTATTGTTCCGCCTGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-444s21c1
Sequence:CCGGGCCTGGTCCTCAACGTCTATACTCGAGTATAGACGTTGAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-1348s21c1
Sequence:CCGGTTCAAGATACCTTCGAGATTCCTCGAGGAATCTCGAAGGTATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024922
VALIDATED
CES3 MISSION shRNA shRNA Plasmid DNA
carboxylesterase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1237s1c1
Sequence:CCGGGCCCACCGTCATAGATGAATACTCGAGTATTCATCTATGACGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1147s1c1
Sequence:CCGGCCTGGATACAATGGAGCAGATCTCGAGATCTGCTCCATTGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1735s1c1
Sequence:CCGGGATACAACAGTGGCACCAGAACTCGAGTTCTGGTGCCACTGTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-393s1c1
Sequence:CCGGGCAGATTTGTCCTCAACGGAACTCGAGTTCCGTTGAGGACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-233s1c1
Sequence:CCGGGACCGCCTTGTGAATGTCTTTCTCGAGAAAGACATTCACAAGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024922.4-1630s21c1
Sequence:CCGGATTCAACCAGGCGGAACAATACTCGAGTATTGTTCCGCCTGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-444s21c1
Sequence:CCGGGCCTGGTCCTCAACGTCTATACTCGAGTATAGACGTTGAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-1348s21c1
Sequence:CCGGTTCAAGATACCTTCGAGATTCCTCGAGGAATCTCGAAGGTATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024922
VALIDATED
CES3 MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1237s1c1
Sequence:CCGGGCCCACCGTCATAGATGAATACTCGAGTATTCATCTATGACGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1147s1c1
Sequence:CCGGCCTGGATACAATGGAGCAGATCTCGAGATCTGCTCCATTGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024922.3-1735s1c1
Sequence:CCGGGATACAACAGTGGCACCAGAACTCGAGTTCTGGTGCCACTGTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-393s1c1
Sequence:CCGGGCAGATTTGTCCTCAACGGAACTCGAGTTCCGTTGAGGACAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024922.3-233s1c1
Sequence:CCGGGACCGCCTTGTGAATGTCTTTCTCGAGAAAGACATTCACAAGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024922.4-1630s21c1
Sequence:CCGGATTCAACCAGGCGGAACAATACTCGAGTATTGTTCCGCCTGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-444s21c1
Sequence:CCGGGCCTGGTCCTCAACGTCTATACTCGAGTATAGACGTTGAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024922.4-1348s21c1
Sequence:CCGGTTCAAGATACCTTCGAGATTCCTCGAGGAATCTCGAAGGTATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks