EMAIL THIS PAGE TO A FRIEND

CES4A

carboxylesterase 4A

108 Gene Product Result for
Synonyms: CES6 CES8
Gene ID:
Human(283848) Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Mouse(234677) carboxylesterase 4A
Rat(291955) carboxylesterase 4A
domestic cat(101087285) carboxylesterase 4A
cow(529706) carboxylesterase 4A
naked mole-rat(101725362) carboxylesterase 4A
domestic guinea pig(100733518) carboxylesterase 4A
sheep(101109991) carboxylesterase 4A
Domestic Rabbit(100359032) carboxylesterase 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085411 MISSION® esiRNA esiRNA human AC009084.9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173815 Rosetta Predictions human pricing
NM_001106176 Rosetta Predictions rat pricing
NM_146213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215787 predicted 1078
2 SASI_Hs01_00215788 predicted 1138
3 SASI_Hs01_00215789 predicted 1505
4 SASI_Hs01_00215791 predicted 1233
5 SASI_Hs02_00368674 predicted 1273
6 SASI_Hs01_00215794 predicted 1509
7 SASI_Hs02_00368675 predicted 1294
8 SASI_Hs01_00215796 predicted 1199
9 SASI_Hs02_00368676 predicted 1575
10 SASI_Hs02_00368677 predicted 1261
11 SASI_Hs01_00215790 predicted 1159
12 SASI_Hs01_00215792 predicted 1528
13 SASI_Hs01_00215793 predicted 1226
14 SASI_Hs01_00215795 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216378 predicted 1074
2 SASI_Rn02_00216379 predicted 1416
3 SASI_Rn02_00216380 predicted 1326
4 SASI_Rn02_00216381 predicted 876
5 SASI_Rn02_00216382 predicted 1244
6 SASI_Rn02_00216383 predicted 1642
7 SASI_Rn02_00216384 predicted 1932
8 SASI_Rn02_00216385 predicted 462
9 SASI_Rn02_00216386 predicted 1260
10 SASI_Rn02_00216387 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059310 predicted 448
2 SASI_Mm01_00059311 predicted 1612
3 SASI_Mm01_00059312 predicted 1271
4 SASI_Mm01_00059313 predicted 1508
5 SASI_Mm01_00059314 predicted 480
6 SASI_Mm01_00059315 predicted 1423
7 SASI_Mm01_00059316 predicted 1634
8 SASI_Mm01_00059317 predicted 1311
9 SASI_Mm01_00059318 predicted 1528
10 SASI_Mm02_00341911 predicted 453
11 SASI_Mm01_00059319 predicted 1525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146213
CES4A MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1227s1c1
Sequence:CCGGGCAGAGTTCGAGTGGAACTTACTCGAGTAAGTTCCACTCGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1401s1c1
Sequence:CCGGGACTGGAAGATGTTCCGAAATCTCGAGATTTCGGAACATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-807s1c1
Sequence:CCGGCCGGACAGTGTAACACTATTTCTCGAGAAATAGTGTTACACTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-995s1c1
Sequence:CCGGCCACAATAGCACGAAGGTCATCTCGAGATGACCTTCGTGCTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1277s1c1
Sequence:CCGGGCGTATGATGAACCAAACCAACTCGAGTTGGTTTGGTTCATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146213
CES4A MISSION shRNA shRNA Plasmid DNA
carboxylesterase 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1227s1c1
Sequence:CCGGGCAGAGTTCGAGTGGAACTTACTCGAGTAAGTTCCACTCGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1401s1c1
Sequence:CCGGGACTGGAAGATGTTCCGAAATCTCGAGATTTCGGAACATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-807s1c1
Sequence:CCGGCCGGACAGTGTAACACTATTTCTCGAGAAATAGTGTTACACTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-995s1c1
Sequence:CCGGCCACAATAGCACGAAGGTCATCTCGAGATGACCTTCGTGCTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1277s1c1
Sequence:CCGGGCGTATGATGAACCAAACCAACTCGAGTTGGTTTGGTTCATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146213
CES4A MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1227s1c1
Sequence:CCGGGCAGAGTTCGAGTGGAACTTACTCGAGTAAGTTCCACTCGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1401s1c1
Sequence:CCGGGACTGGAAGATGTTCCGAAATCTCGAGATTTCGGAACATCTTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-807s1c1
Sequence:CCGGCCGGACAGTGTAACACTATTTCTCGAGAAATAGTGTTACACTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-995s1c1
Sequence:CCGGCCACAATAGCACGAAGGTCATCTCGAGATGACCTTCGTGCTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146213.1-1277s1c1
Sequence:CCGGGCGTATGATGAACCAAACCAACTCGAGTTGGTTTGGTTCATCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173815
CES4A MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 4A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1193s1c1
Sequence:CCGGGCACCGCGTTATTCAGACTTTCTCGAGAAAGTCTGAATAACGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-409s1c1
Sequence:CCGGCCTCAAGTGGTCACCAAATATCTCGAGATATTTGGTGACCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1609s1c1
Sequence:CCGGCGAAACCGTATGATGGACATACTCGAGTATGTCCATCATACGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-375s1c1
Sequence:CCGGAGGAACAAATACAGGTGCCTTCTCGAGAAGGCACCTGTATTTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1464s1c1
Sequence:CCGGGAAGGTTTCATCTGTGCCCTACTCGAGTAGGGCACAGATGAAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1161s21c1
Sequence:CCGGAGTACCTGGACAATGTCAATGCTCGAGCATTGACATTGTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1474s21c1
Sequence:CCGGGAGTCTGTACCAGTCTCAAAGCTCGAGCTTTGAGACTGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-929s21c1
Sequence:CCGGGTGTCCAACAAGATGAGATTCCTCGAGGAATCTCATCTTGTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1105s21c1
Sequence:CCGGCAATTGGCTCTTGCCTTATAACTCGAGTTATAAGGCAAGAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173815
CES4A MISSION shRNA shRNA Plasmid DNA
carboxylesterase 4A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1193s1c1
Sequence:CCGGGCACCGCGTTATTCAGACTTTCTCGAGAAAGTCTGAATAACGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-409s1c1
Sequence:CCGGCCTCAAGTGGTCACCAAATATCTCGAGATATTTGGTGACCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1609s1c1
Sequence:CCGGCGAAACCGTATGATGGACATACTCGAGTATGTCCATCATACGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-375s1c1
Sequence:CCGGAGGAACAAATACAGGTGCCTTCTCGAGAAGGCACCTGTATTTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1464s1c1
Sequence:CCGGGAAGGTTTCATCTGTGCCCTACTCGAGTAGGGCACAGATGAAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1161s21c1
Sequence:CCGGAGTACCTGGACAATGTCAATGCTCGAGCATTGACATTGTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1474s21c1
Sequence:CCGGGAGTCTGTACCAGTCTCAAAGCTCGAGCTTTGAGACTGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-929s21c1
Sequence:CCGGGTGTCCAACAAGATGAGATTCCTCGAGGAATCTCATCTTGTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1105s21c1
Sequence:CCGGCAATTGGCTCTTGCCTTATAACTCGAGTTATAAGGCAAGAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173815
CES4A MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 4A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1193s1c1
Sequence:CCGGGCACCGCGTTATTCAGACTTTCTCGAGAAAGTCTGAATAACGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-409s1c1
Sequence:CCGGCCTCAAGTGGTCACCAAATATCTCGAGATATTTGGTGACCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1609s1c1
Sequence:CCGGCGAAACCGTATGATGGACATACTCGAGTATGTCCATCATACGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-375s1c1
Sequence:CCGGAGGAACAAATACAGGTGCCTTCTCGAGAAGGCACCTGTATTTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173815.3-1464s1c1
Sequence:CCGGGAAGGTTTCATCTGTGCCCTACTCGAGTAGGGCACAGATGAAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1161s21c1
Sequence:CCGGAGTACCTGGACAATGTCAATGCTCGAGCATTGACATTGTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1474s21c1
Sequence:CCGGGAGTCTGTACCAGTCTCAAAGCTCGAGCTTTGAGACTGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-929s21c1
Sequence:CCGGGTGTCCAACAAGATGAGATTCCTCGAGGAATCTCATCTTGTTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173815.4-1105s21c1
Sequence:CCGGCAATTGGCTCTTGCCTTATAACTCGAGTTATAAGGCAAGAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks