EMAIL THIS PAGE TO A FRIEND

CES5A

carboxylesterase 5A

81 Gene Product Result for
Synonyms: CAUXIN CES4C1 CES5 CES7
UniProtKB ID: Q6NT32, B7Z252, B7ZLB6, Q8NBC8, Q96DN9
Gene ID:
Human(221223) Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(67935) carboxylesterase 5A
Rat(307660) carboxylesterase 5A
Domestic Rabbit(100355533) carboxylesterase 5A
domestic guinea pig(100716923) carboxylesterase 5A
cow(513992) carboxylesterase 5A
domestic cat(445455) carboxylesterase 5A
dog(445456) carboxylesterase 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145024 Rosetta Predictions human pricing
NM_001012056 Rosetta Predictions rat pricing
XM_574201 Rosetta Predictions rat pricing
NM_001003951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139414 predicted 834
2 SASI_Hs01_00139415 predicted 410
3 SASI_Hs02_00364879 predicted 414
4 SASI_Hs01_00139417 predicted 971
5 SASI_Hs01_00139421 predicted 1066
6 SASI_Hs02_00364880 predicted 972
7 SASI_Hs02_00364881 predicted 209
8 SASI_Hs02_00364882 predicted 1304
9 SASI_Hs02_00364883 predicted 483
10 SASI_Hs02_00364884 predicted 1772
11 SASI_Hs01_00139413 predicted 1120
12 SASI_Hs01_00139416 predicted 1342
13 SASI_Hs01_00139418 predicted 1199
14 SASI_Hs01_00139419 predicted 1355
15 SASI_Hs01_00139420 predicted 1158
16 SASI_Hs01_00139422 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112841 predicted 1118
2 SASI_Rn01_00112842 predicted 921
3 SASI_Rn02_00200162 predicted 801
4 SASI_Rn01_00112843 predicted 1848
5 SASI_Rn01_00112845 predicted 538
6 SASI_Rn01_00112846 predicted 383
7 SASI_Rn01_00112847 predicted 259
8 SASI_Rn01_00112848 predicted 742
9 SASI_Rn01_00112849 predicted 940
10 SASI_Rn02_00200163 predicted 974
11 SASI_Rn01_00112844 predicted 820
12 SASI_Rn01_00112850 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152165 predicted 512
2 SASI_Rn01_00152166 predicted 626
3 SASI_Rn01_00152167 predicted 594
4 SASI_Rn01_00152168 predicted 531
5 SASI_Rn01_00152169 predicted 627
6 SASI_Rn01_00152170 predicted 631
7 SASI_Rn01_00152171 predicted 592
8 SASI_Rn01_00152172 predicted 630
9 SASI_Rn01_00152173 predicted 509
10 SASI_Rn01_00152174 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152124 predicted 1004
2 SASI_Mm01_00152125 predicted 690
3 SASI_Mm01_00152126 predicted 824
4 SASI_Mm01_00152127 predicted 481
5 SASI_Mm01_00152128 predicted 528
6 SASI_Mm01_00152129 predicted 706
7 SASI_Mm02_00286409 predicted 835
8 SASI_Mm01_00152131 predicted 1066
9 SASI_Mm01_00152132 predicted 666
10 SASI_Mm01_00152133 predicted 629
11 SASI_Mm01_00152130 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145024
CES5A MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 5A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1769s21c1
Sequence:CCGGTAATTTCTCCCGCAATCATTACTCGAGTAATGATTGCGGGAGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1834s21c1
Sequence:CCGGACAAGCTGCTTTCGCTGATATCTCGAGATATCAGCGAAAGCAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-449s21c1
Sequence:CCGGGCTGCTCTTAGATCAACATATCTCGAGATATGTTGATCTAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1274s21c1
Sequence:CCGGGCACATCCCGCCTCAGTATTTCTCGAGAAATACTGAGGCGGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1485s21c1
Sequence:CCGGGCTCGAACCGGGAATCCTAATCTCGAGATTAGGATTCCCGGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-419s1c1
Sequence:CCGGCCCTAATTTGTGCCTCCAGAACTCGAGTTCTGGAGGCACAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1663s1c1
Sequence:CCGGGTCCTCTTTCTTCCTTAACTTCTCGAGAAGTTAAGGAAGAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1156s1c1
Sequence:CCGGCTTCCATTATCGGAGTCAATACTCGAGTATTGACTCCGATAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-829s1c1
Sequence:CCGGCGGGAGCCATAAGTGTTTCTACTCGAGTAGAAACACTTATGGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-473s1c1
Sequence:CCGGCAAGGTGCATTACCCGAAATTCTCGAGAATTTCGGGTAATGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145024
CES5A MISSION shRNA shRNA Plasmid DNA
carboxylesterase 5A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1769s21c1
Sequence:CCGGTAATTTCTCCCGCAATCATTACTCGAGTAATGATTGCGGGAGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1834s21c1
Sequence:CCGGACAAGCTGCTTTCGCTGATATCTCGAGATATCAGCGAAAGCAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-449s21c1
Sequence:CCGGGCTGCTCTTAGATCAACATATCTCGAGATATGTTGATCTAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1274s21c1
Sequence:CCGGGCACATCCCGCCTCAGTATTTCTCGAGAAATACTGAGGCGGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1485s21c1
Sequence:CCGGGCTCGAACCGGGAATCCTAATCTCGAGATTAGGATTCCCGGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-419s1c1
Sequence:CCGGCCCTAATTTGTGCCTCCAGAACTCGAGTTCTGGAGGCACAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1663s1c1
Sequence:CCGGGTCCTCTTTCTTCCTTAACTTCTCGAGAAGTTAAGGAAGAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1156s1c1
Sequence:CCGGCTTCCATTATCGGAGTCAATACTCGAGTATTGACTCCGATAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-829s1c1
Sequence:CCGGCGGGAGCCATAAGTGTTTCTACTCGAGTAGAAACACTTATGGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-473s1c1
Sequence:CCGGCAAGGTGCATTACCCGAAATTCTCGAGAATTTCGGGTAATGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145024
CES5A MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 5A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1769s21c1
Sequence:CCGGTAATTTCTCCCGCAATCATTACTCGAGTAATGATTGCGGGAGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145024.2-1834s21c1
Sequence:CCGGACAAGCTGCTTTCGCTGATATCTCGAGATATCAGCGAAAGCAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-449s21c1
Sequence:CCGGGCTGCTCTTAGATCAACATATCTCGAGATATGTTGATCTAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1274s21c1
Sequence:CCGGGCACATCCCGCCTCAGTATTTCTCGAGAAATACTGAGGCGGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145024.2-1485s21c1
Sequence:CCGGGCTCGAACCGGGAATCCTAATCTCGAGATTAGGATTCCCGGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-419s1c1
Sequence:CCGGCCCTAATTTGTGCCTCCAGAACTCGAGTTCTGGAGGCACAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1663s1c1
Sequence:CCGGGTCCTCTTTCTTCCTTAACTTCTCGAGAAGTTAAGGAAGAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-1156s1c1
Sequence:CCGGCTTCCATTATCGGAGTCAATACTCGAGTATTGACTCCGATAATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-829s1c1
Sequence:CCGGCGGGAGCCATAAGTGTTTCTACTCGAGTAGAAACACTTATGGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145024.1-473s1c1
Sequence:CCGGCAAGGTGCATTACCCGAAATTCTCGAGAATTTCGGGTAATGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003951
CES5A MISSION shRNA Bacterial Glycerol Stock
carboxylesterase 5A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-715s21c1
Sequence:CCGGCCTTTGAGTGCGGACTTATTCCTCGAGGAATAAGTCCGCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-30s21c1
Sequence:CCGGAGCCCTAATCTGGGTTATTTGCTCGAGCAAATAACCCAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1008s21c1
Sequence:CCGGTTCTATCATTGGAGTCAATAACTCGAGTTATTGACTCCAATGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-152s21c1
Sequence:CCGGTGGAACCCGTGAACGTGTTTCCTCGAGGAAACACGTTCACGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1189s21c1
Sequence:CCGGACCGACATCCGAGACACTTTACTCGAGTAAAGTGTCTCGGATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003951
CES5A MISSION shRNA shRNA Plasmid DNA
carboxylesterase 5A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-715s21c1
Sequence:CCGGCCTTTGAGTGCGGACTTATTCCTCGAGGAATAAGTCCGCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-30s21c1
Sequence:CCGGAGCCCTAATCTGGGTTATTTGCTCGAGCAAATAACCCAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1008s21c1
Sequence:CCGGTTCTATCATTGGAGTCAATAACTCGAGTTATTGACTCCAATGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-152s21c1
Sequence:CCGGTGGAACCCGTGAACGTGTTTCCTCGAGGAAACACGTTCACGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1189s21c1
Sequence:CCGGACCGACATCCGAGACACTTTACTCGAGTAAAGTGTCTCGGATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003951
CES5A MISSION shRNA Lentiviral Transduction Particles
carboxylesterase 5A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-715s21c1
Sequence:CCGGCCTTTGAGTGCGGACTTATTCCTCGAGGAATAAGTCCGCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-30s21c1
Sequence:CCGGAGCCCTAATCTGGGTTATTTGCTCGAGCAAATAACCCAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1008s21c1
Sequence:CCGGTTCTATCATTGGAGTCAATAACTCGAGTTATTGACTCCAATGATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-152s21c1
Sequence:CCGGTGGAACCCGTGAACGTGTTTCCTCGAGGAAACACGTTCACGGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003951.1-1189s21c1
Sequence:CCGGACCGACATCCGAGACACTTTACTCGAGTAAAGTGTCTCGGATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks