EMAIL THIS PAGE TO A FRIEND

CETN1

centrin, EF-hand protein, 1

67 Gene Product Result for
Synonyms: CEN1 CETN
UniProtKB ID: Q12798, B2R536
Gene ID:
Human(1068) Summary: The protein encoded by this gene plays important roles in the determination of centrosome position and segregation, and in the process of microtubule severing. This encoded protein is localized to the centrosome of interphase cells, and redistributes to the region of the spindle poles during mitosis, reflecting the dynamic behavior of the centrosome during the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(26369) centrin 1
Rat(84592) centrin, EF-hand protein, 1
naked mole-rat(101720903) centrin, EF-hand protein, 1
domestic guinea pig(100719990) centrin, EF-hand protein, 1
sheep(101103202) centrin, EF-hand protein, 1
chicken(422668) centrin, EF-hand protein, 1
domestic cat(101091735) centrin, EF-hand protein, 1
cow(512850) centrin, EF-hand protein, 1
dog(490531) centrin, EF-hand protein, 1
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120911 MISSION® esiRNA esiRNA human CETN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004066 Rosetta Predictions human pricing
XM_001071230 Rosetta Predictions rat pricing
XM_344646 Rosetta Predictions rat pricing
NM_007593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018245 predicted 578
2 SASI_Hs01_00018246 predicted 565
3 SASI_Hs01_00018247 predicted 477
4 SASI_Hs01_00018248 predicted 758
5 SASI_Hs01_00018251 predicted 199
6 SASI_Hs01_00018252 predicted 312
7 SASI_Hs01_00018253 predicted 903
8 SASI_Hs02_00336855 predicted 805
9 SASI_Hs02_00336856 predicted 794
10 SASI_Hs02_00336857 predicted 329
11 SASI_Hs01_00018244 predicted 901
12 SASI_Hs01_00018249 predicted 227
13 SASI_Hs01_00018250 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334257 predicted 377
2 SASI_Rn02_00334258 predicted 240
3 SASI_Rn02_00334259 predicted 271
4 SASI_Rn02_00334260 predicted 533
5 SASI_Rn02_00334261 predicted 701
6 SASI_Rn02_00334262 predicted 533
7 SASI_Rn02_00334263 predicted 707
8 SASI_Rn02_00334264 predicted 786
9 SASI_Rn02_00334265 predicted 240
10 SASI_Rn02_00334266 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397385 predicted 382
2 SASI_Rn02_00397386 predicted 236
3 SASI_Rn02_00397387 predicted 269
4 SASI_Rn02_00397388 predicted 541
5 SASI_Rn02_00397389 predicted 701
6 SASI_Rn02_00397390 predicted 537
7 SASI_Rn02_00397391 predicted 703
8 SASI_Rn02_00397392 predicted 786
9 SASI_Rn02_00397393 predicted 241
10 SASI_Rn02_00397394 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084566 predicted 293
2 SASI_Mm01_00084569 predicted 355
3 SASI_Mm01_00084570 predicted 209
4 SASI_Mm01_00084574 predicted 783
5 SASI_Mm02_00312020 predicted 689
6 SASI_Mm01_00084565 predicted 664
7 SASI_Mm01_00084567 predicted 642
8 SASI_Mm01_00084568 predicted 265
9 SASI_Mm01_00084571 predicted 521
10 SASI_Mm01_00084572 predicted 530
11 SASI_Mm01_00084573 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004066
CETN1 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-132s1c1
Sequence:CCGGGCAAGAAGTTCGGGAAGCATTCTCGAGAATGCTTCCCGAACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-127s1c1
Sequence:CCGGCAGAAGCAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-288s1c1
Sequence:CCGGGAAGATCAGCTTCAATGACTTCTCGAGAAGTCATTGAAGCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-334s1c1
Sequence:CCGGTCCGAGAAGGACACCAAAGAACTCGAGTTCTTTGGTGTCCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-472s1c1
Sequence:CCGGGAGATGATCGACGAAGCTGATCTCGAGATCAGCTTCGTCGATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004066
CETN1 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-132s1c1
Sequence:CCGGGCAAGAAGTTCGGGAAGCATTCTCGAGAATGCTTCCCGAACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-127s1c1
Sequence:CCGGCAGAAGCAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-288s1c1
Sequence:CCGGGAAGATCAGCTTCAATGACTTCTCGAGAAGTCATTGAAGCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-334s1c1
Sequence:CCGGTCCGAGAAGGACACCAAAGAACTCGAGTTCTTTGGTGTCCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-472s1c1
Sequence:CCGGGAGATGATCGACGAAGCTGATCTCGAGATCAGCTTCGTCGATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004066
CETN1 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-132s1c1
Sequence:CCGGGCAAGAAGTTCGGGAAGCATTCTCGAGAATGCTTCCCGAACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-127s1c1
Sequence:CCGGCAGAAGCAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-288s1c1
Sequence:CCGGGAAGATCAGCTTCAATGACTTCTCGAGAAGTCATTGAAGCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-334s1c1
Sequence:CCGGTCCGAGAAGGACACCAAAGAACTCGAGTTCTTTGGTGTCCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004066.1-472s1c1
Sequence:CCGGGAGATGATCGACGAAGCTGATCTCGAGATCAGCTTCGTCGATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007593
VALIDATED
CETN1 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007593.3-833s1c1
Sequence:CCGGCGTGGTTCTCTGGTCACTTTACTCGAGTAAAGTGACCAGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-391s1c1
Sequence:CCGGGATGACGACGAAACTGGGAAACTCGAGTTTCCCAGTTTCGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-84s1c1
Sequence:CCGGCTCTACCAGCTACAAGAGAAACTCGAGTTTCTCTTGTAGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-348s1c1
Sequence:CCGGGAAAGATACCAAAGAGGAAATCTCGAGATTTCCTCTTTGGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-118s1c1
Sequence:CCGGCCTGAACTCACCGAAGATCAACTCGAGTTGATCTTCGGTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007593.5-665s21c1
Sequence:CCGGTCTAAGCCTCTAGATCAATTACTCGAGTAATTGATCTAGAGGCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-370s21c1
Sequence:CCGGTGAAGGCTTTCAGGTTGTTTGCTCGAGCAAACAACCTGAAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-521s21c1
Sequence:CCGGGAACGAGGAAGAGTTTCTTAACTCGAGTTAAGAAACTCTTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-115s21c1
Sequence:CCGGAGCCTGAACTCACCGAAGATCCTCGAGGATCTTCGGTGAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-155s21c1
Sequence:CCGGAGCCTTTGACCTCTTCGATTCCTCGAGGAATCGAAGAGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007593
VALIDATED
CETN1 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007593.3-833s1c1
Sequence:CCGGCGTGGTTCTCTGGTCACTTTACTCGAGTAAAGTGACCAGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-391s1c1
Sequence:CCGGGATGACGACGAAACTGGGAAACTCGAGTTTCCCAGTTTCGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-84s1c1
Sequence:CCGGCTCTACCAGCTACAAGAGAAACTCGAGTTTCTCTTGTAGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-348s1c1
Sequence:CCGGGAAAGATACCAAAGAGGAAATCTCGAGATTTCCTCTTTGGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-118s1c1
Sequence:CCGGCCTGAACTCACCGAAGATCAACTCGAGTTGATCTTCGGTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007593.5-665s21c1
Sequence:CCGGTCTAAGCCTCTAGATCAATTACTCGAGTAATTGATCTAGAGGCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-370s21c1
Sequence:CCGGTGAAGGCTTTCAGGTTGTTTGCTCGAGCAAACAACCTGAAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-521s21c1
Sequence:CCGGGAACGAGGAAGAGTTTCTTAACTCGAGTTAAGAAACTCTTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-115s21c1
Sequence:CCGGAGCCTGAACTCACCGAAGATCCTCGAGGATCTTCGGTGAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-155s21c1
Sequence:CCGGAGCCTTTGACCTCTTCGATTCCTCGAGGAATCGAAGAGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007593
VALIDATED
CETN1 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007593.3-833s1c1
Sequence:CCGGCGTGGTTCTCTGGTCACTTTACTCGAGTAAAGTGACCAGAGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-391s1c1
Sequence:CCGGGATGACGACGAAACTGGGAAACTCGAGTTTCCCAGTTTCGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-84s1c1
Sequence:CCGGCTCTACCAGCTACAAGAGAAACTCGAGTTTCTCTTGTAGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007593.3-348s1c1
Sequence:CCGGGAAAGATACCAAAGAGGAAATCTCGAGATTTCCTCTTTGGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007593.3-118s1c1
Sequence:CCGGCCTGAACTCACCGAAGATCAACTCGAGTTGATCTTCGGTGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007593.5-665s21c1
Sequence:CCGGTCTAAGCCTCTAGATCAATTACTCGAGTAATTGATCTAGAGGCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-370s21c1
Sequence:CCGGTGAAGGCTTTCAGGTTGTTTGCTCGAGCAAACAACCTGAAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-521s21c1
Sequence:CCGGGAACGAGGAAGAGTTTCTTAACTCGAGTTAAGAAACTCTTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-115s21c1
Sequence:CCGGAGCCTGAACTCACCGAAGATCCTCGAGGATCTTCGGTGAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007593.5-155s21c1
Sequence:CCGGAGCCTTTGACCTCTTCGATTCCTCGAGGAATCGAAGAGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks