EMAIL THIS PAGE TO A FRIEND

CETN2

centrin, EF-hand protein, 2

Synonyms: CALT CEN2
UniProtKB ID: P41208, B2R4T4, Q53XW1
Gene ID:
Human(1069) Summary: Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome. [provided by RefSeq, Jul 2008]
Mouse(26370) centrin 2
Rat(84593) centrin, EF-hand protein, 2
Zebrafish(795310) centrin, EF-hand protein, 2
cow(508601) centrin, EF-hand protein, 2
domestic cat(101096298) centrin, EF-hand protein, 2
dog(481078) centrin, EF-hand protein, 2
chicken(422303) centrin, EF-hand protein, 2
sheep(100302545) centrin, EF-hand protein, 2
domestic guinea pig(100728564) centrin, EF-hand protein, 2
naked mole-rat(101715233) centrin, EF-hand protein, 2
Gene Class: Calcium_Binding
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004344 Rosetta Predictions human pricing
XM_001053739 Rosetta Predictions rat pricing
XM_215222 Rosetta Predictions rat pricing
NM_019405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031868 predicted 711
2 SASI_Hs01_00031869 predicted 705
3 SASI_Hs01_00031870 predicted 390
4 SASI_Hs01_00031871 predicted 369
5 SASI_Hs01_00031872 predicted 427
6 SASI_Hs01_00031873 predicted 665
7 SASI_Hs01_00031874 predicted 804
8 SASI_Hs01_00031875 predicted 853
9 SASI_Hs01_00031876 predicted 445
10 SASI_Hs01_00031877 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273426 predicted 847
2 SASI_Rn02_00273427 predicted 992
3 SASI_Rn02_00273428 predicted 1102
4 SASI_Rn02_00273429 predicted 220
5 SASI_Rn02_00273430 predicted 1098
6 SASI_Rn02_00273431 predicted 272
7 SASI_Rn02_00273432 predicted 716
8 SASI_Rn02_00273433 predicted 669
9 SASI_Rn02_00273434 predicted 670
10 SASI_Rn02_00273435 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375875 predicted 851
2 SASI_Rn02_00375876 predicted 995
3 SASI_Rn02_00375877 predicted 1099
4 SASI_Rn02_00375878 predicted 222
5 SASI_Rn02_00375879 predicted 1098
6 SASI_Rn02_00375880 predicted 272
7 SASI_Rn02_00375881 predicted 716
8 SASI_Rn02_00375882 predicted 661
9 SASI_Rn02_00375883 predicted 669
10 SASI_Rn02_00375884 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051579 predicted 345
2 SASI_Mm01_00051581 predicted 858
3 SASI_Mm02_00324327 predicted 851
4 SASI_Mm01_00051582 predicted 536
5 SASI_Mm01_00051584 predicted 866
6 SASI_Mm01_00051585 predicted 646
7 SASI_Mm02_00324328 predicted 438
8 SASI_Mm01_00051587 predicted 236
9 SASI_Mm02_00324329 predicted 829
10 SASI_Mm01_00051588 predicted 820
11 SASI_Mm01_00051580 predicted 886
12 SASI_Mm01_00051583 predicted 715
13 SASI_Mm01_00051586 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004344
VALIDATED
CETN2 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-551s21c1
Sequence:CCGGGACCAGCCTCTATTAAGATCACTCGAGTGATCTTAATAGAGGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-882s21c1
Sequence:CCGGCACAAACACAGAACGACTTTACTCGAGTAAAGTCGTTCTGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-485s21c1
Sequence:CCGGTGATGAAGCTGATCGAGATGGCTCGAGCCATCTCGATCAGCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-366s21c1
Sequence:CCGGCTGAAAGCTTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-666s21c1
Sequence:CCGGGGACCTCCCTTTATCACTTTACTCGAGTAAAGTGATAAAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-234s1c1
Sequence:CCGGGAACCCAAGAAAGAAGAAATTCTCGAGAATTTCTTCTTTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004344.1-225s1c1
Sequence:CCGGCTGGGCTTTGAACCCAAGAAACTCGAGTTTCTTGGGTTCAAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-180s1c1
Sequence:CCGGACTGGCACCATAGATGTTAAACTCGAGTTTAACATCTATGGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-108s1c1
Sequence:CCGGCCTAAGCCTGAGCTTACTGAACTCGAGTTCAGTAAGCTCAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-114s1c1
Sequence:CCGGCCTGAGCTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004344
VALIDATED
CETN2 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-551s21c1
Sequence:CCGGGACCAGCCTCTATTAAGATCACTCGAGTGATCTTAATAGAGGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-882s21c1
Sequence:CCGGCACAAACACAGAACGACTTTACTCGAGTAAAGTCGTTCTGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-485s21c1
Sequence:CCGGTGATGAAGCTGATCGAGATGGCTCGAGCCATCTCGATCAGCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-366s21c1
Sequence:CCGGCTGAAAGCTTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-666s21c1
Sequence:CCGGGGACCTCCCTTTATCACTTTACTCGAGTAAAGTGATAAAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-234s1c1
Sequence:CCGGGAACCCAAGAAAGAAGAAATTCTCGAGAATTTCTTCTTTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004344.1-225s1c1
Sequence:CCGGCTGGGCTTTGAACCCAAGAAACTCGAGTTTCTTGGGTTCAAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-180s1c1
Sequence:CCGGACTGGCACCATAGATGTTAAACTCGAGTTTAACATCTATGGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-108s1c1
Sequence:CCGGCCTAAGCCTGAGCTTACTGAACTCGAGTTCAGTAAGCTCAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-114s1c1
Sequence:CCGGCCTGAGCTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004344
VALIDATED
CETN2 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-551s21c1
Sequence:CCGGGACCAGCCTCTATTAAGATCACTCGAGTGATCTTAATAGAGGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-882s21c1
Sequence:CCGGCACAAACACAGAACGACTTTACTCGAGTAAAGTCGTTCTGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-485s21c1
Sequence:CCGGTGATGAAGCTGATCGAGATGGCTCGAGCCATCTCGATCAGCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004344.1-366s21c1
Sequence:CCGGCTGAAAGCTTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004344.1-666s21c1
Sequence:CCGGGGACCTCCCTTTATCACTTTACTCGAGTAAAGTGATAAAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-234s1c1
Sequence:CCGGGAACCCAAGAAAGAAGAAATTCTCGAGAATTTCTTCTTTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004344.1-225s1c1
Sequence:CCGGCTGGGCTTTGAACCCAAGAAACTCGAGTTTCTTGGGTTCAAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-180s1c1
Sequence:CCGGACTGGCACCATAGATGTTAAACTCGAGTTTAACATCTATGGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-108s1c1
Sequence:CCGGCCTAAGCCTGAGCTTACTGAACTCGAGTTCAGTAAGCTCAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004344.1-114s1c1
Sequence:CCGGCCTGAGCTTACTGAAGAGCAACTCGAGTTGCTCTTCAGTAAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019405
VALIDATED
CETN2 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-657s21c1
Sequence:CCGGGCCATGACCTTGAATCTATTTCTCGAGAAATAGATTCAAGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-506s21c1
Sequence:CCGGCAAGAGTTCCTGCGCATCATGCTCGAGCATGATGCGCAGGAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-161s21c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-98s21c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019405.6-353s21c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-99s1c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-354s1c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-162s1c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-218s1c1
Sequence:CCGGGCCCAAGAAAGAAGAAATTAACTCGAGTTAATTTCTTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019405
VALIDATED
CETN2 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-657s21c1
Sequence:CCGGGCCATGACCTTGAATCTATTTCTCGAGAAATAGATTCAAGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-506s21c1
Sequence:CCGGCAAGAGTTCCTGCGCATCATGCTCGAGCATGATGCGCAGGAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-161s21c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-98s21c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019405.6-353s21c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-99s1c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-354s1c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-162s1c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-218s1c1
Sequence:CCGGGCCCAAGAAAGAAGAAATTAACTCGAGTTAATTTCTTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019405
VALIDATED
CETN2 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-657s21c1
Sequence:CCGGGCCATGACCTTGAATCTATTTCTCGAGAAATAGATTCAAGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-506s21c1
Sequence:CCGGCAAGAGTTCCTGCGCATCATGCTCGAGCATGATGCGCAGGAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-161s21c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019405.6-98s21c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019405.6-353s21c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-99s1c1
Sequence:CCGGGAACTTACTGAAGACCAGAAACTCGAGTTTCTGGTCTTCAGTAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-354s1c1
Sequence:CCGGGCTTTCAAGTTGTTCGATGATCTCGAGATCATCGAACAACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-162s1c1
Sequence:CCGGACTGGAACTATAGACATCAAACTCGAGTTTGATGTCTATAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019405.5-218s1c1
Sequence:CCGGGCCCAAGAAAGAAGAAATTAACTCGAGTTAATTTCTTCTTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks