EMAIL THIS PAGE TO A FRIEND

CETN3

centrin, EF-hand protein, 3

63 Gene Product Result for
Synonyms: CDC31 CEN3
UniProtKB ID: O15182, Q53YD2, Q9BS23
Gene ID:
Human(1070) Summary: The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. [provided by RefSeq, Jul 2008]
Mouse(12626) centrin 3
Rat(170895) centrin, EF-hand protein, 3
naked mole-rat(101720737) centrin, EF-hand protein, 3
domestic guinea pig(100724807) centrin, EF-hand protein, 3
sheep(101106324) centrin, EF-hand protein, 3
Zebrafish(552931) centrin 3
chicken(427104) centrin, EF-hand protein, 3
cow(532953) centrin, EF-hand protein, 3
domestic cat(101098685) centrin, EF-hand protein, 3
dog(488915) centrin, EF-hand protein, 3
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040581 MISSION® esiRNA esiRNA targeting human CETN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004365 Rosetta Predictions human pricing
XM_001061358 Rosetta Predictions rat pricing
XM_342168 Rosetta Predictions rat pricing
NM_007684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225524 predicted 600
2 SASI_Hs01_00225525 predicted 249
3 SASI_Hs01_00225526 predicted 433
4 SASI_Hs01_00225527 predicted 384
5 SASI_Hs01_00225528 predicted 649
6 SASI_Hs01_00225529 predicted 386
7 SASI_Hs01_00225530 predicted 544
8 SASI_Hs01_00225531 predicted 240
9 SASI_Hs01_00225532 predicted 489
10 SASI_Hs01_00225533 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299756 predicted 389
2 SASI_Rn02_00299757 predicted 573
3 SASI_Rn02_00299758 predicted 390
4 SASI_Rn02_00299759 predicted 720
5 SASI_Rn02_00299760 predicted 382
6 SASI_Rn02_00299761 predicted 510
7 SASI_Rn02_00299762 predicted 586
8 SASI_Rn02_00299763 predicted 584
9 SASI_Rn02_00299764 predicted 401
10 SASI_Rn02_00299765 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393841 predicted 392
2 SASI_Rn02_00393842 predicted 569
3 SASI_Rn02_00393843 predicted 399
4 SASI_Rn02_00393844 predicted 720
5 SASI_Rn02_00393845 predicted 383
6 SASI_Rn02_00393846 predicted 512
7 SASI_Rn02_00393847 predicted 590
8 SASI_Rn02_00393848 predicted 585
9 SASI_Rn02_00393849 predicted 399
10 SASI_Rn02_00393850 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079639 predicted 346
2 SASI_Mm01_00079640 predicted 529
3 SASI_Mm01_00079641 predicted 467
4 SASI_Mm01_00079642 predicted 578
5 SASI_Mm01_00079643 predicted 342
6 SASI_Mm01_00079644 predicted 311
7 SASI_Mm01_00079645 predicted 311
8 SASI_Mm01_00079646 predicted 358
9 SASI_Mm02_00312216 predicted 496
10 SASI_Mm01_00079647 predicted 469
11 SASI_Mm01_00079648 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004365
VALIDATED
CETN3 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-315s1c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-494s1c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-606s1c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004365.2-426s1c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-189s1c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-189s21c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-315s21c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-606s21c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-494s21c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-426s21c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004365
VALIDATED
CETN3 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-315s1c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-494s1c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-606s1c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004365.2-426s1c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-189s1c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-189s21c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-315s21c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-606s21c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-494s21c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-426s21c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004365
VALIDATED
CETN3 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-315s1c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-494s1c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-606s1c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004365.2-426s1c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004365.2-189s1c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-189s21c1
Sequence:CCGGCTGTCTGAGGAACAGAAACAACTCGAGTTGTTTCTGTTCCTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-315s21c1
Sequence:CCGGGCTGATGTACTGAAGATTCTTCTCGAGAAGAATCTTCAGTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-606s21c1
Sequence:CCGGGCTATTATGACTGGTGACATTCTCGAGAATGTCACCAGTCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-494s21c1
Sequence:CCGGGCGACGTGTTGCTAGAGAATTCTCGAGAATTCTCTAGCAACACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004365.2-426s21c1
Sequence:CCGGGAAGAAATACTCAAGGCATTTCTCGAGAAATGCCTTGAGTATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007684
VALIDATED
CETN3 MISSION shRNA Bacterial Glycerol Stock
centrin, EF-hand protein, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-667s1c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-382s1c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-154s1c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-504s1c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-239s1c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007684.3-667s21c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-154s21c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-382s21c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-504s21c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-239s21c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007684
VALIDATED
CETN3 MISSION shRNA shRNA Plasmid DNA
centrin, EF-hand protein, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-667s1c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-382s1c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-154s1c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-504s1c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-239s1c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007684.3-667s21c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-154s21c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-382s21c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-504s21c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-239s21c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007684
VALIDATED
CETN3 MISSION shRNA Lentiviral Transduction Particles
centrin, EF-hand protein, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-667s1c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-382s1c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-154s1c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-504s1c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007684.2-239s1c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007684.3-667s21c1
Sequence:CCGGCCAAGCATCCTTTGTATGTATCTCGAGATACATACAAAGGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-154s21c1
Sequence:CCGGGCTGTTTGATACCGACAAAGACTCGAGTCTTTGTCGGTATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-382s21c1
Sequence:CCGGCGATGACGATTCAGGAAAGATCTCGAGATCTTTCCTGAATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-504s21c1
Sequence:CCGGGAGAGATAAATCAAGAGGAATCTCGAGATTCCTCTTGATTTATCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007684.3-239s21c1
Sequence:CCGGGCTGATGTGTTGAAGATTCTTCTCGAGAAGAATCTTCAACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks