EMAIL THIS PAGE TO A FRIEND

CETP

cholesteryl ester transfer protein, plasma

29 Gene Product Result for
Synonyms: BPIFF HDLCQ10
Species: Human CETP(1071), Zebrafish cetp(492488), chicken CETP(415645), naked mole-rat Cetp(101703105), domestic guinea pig Cetp(100725583), Domestic Rabbit CETP(100327267)
UniProtKB ID: P11597, Q13987, Q13988, Q53YZ1
Gene ID:
Human(1071) Summary: Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters between lipoproteins. CETP may effect susceptibility to atherosclerosis. [provided by RefSeq, Jul 2008]
Zebrafish(492488) cholesteryl ester transfer protein, plasma
chicken(415645) cholesteryl ester transfer protein, plasma
naked mole-rat(101703105) cholesteryl ester transfer protein, plasma
domestic guinea pig(100725583) cholesteryl ester transfer protein, plasma
Domestic Rabbit(100327267) cholesteryl ester transfer protein, plasma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK106 CETP Activity Assay Kit Supplied by Roar Biomedical, Inc. human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023931 MISSION® esiRNA esiRNA human CETP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000078 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141161 predicted 1281
2 SASI_Hs01_00141162 predicted 250
3 SASI_Hs01_00141163 predicted 1381
4 SASI_Hs01_00141164 predicted 648
5 SASI_Hs01_00141165 predicted 998
6 SASI_Hs01_00141166 predicted 1439
7 SASI_Hs01_00141167 predicted 439
8 SASI_Hs01_00141168 predicted 722
9 SASI_Hs01_00141169 predicted 422
10 SASI_Hs01_00141170 predicted 1426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000078
CETP MISSION shRNA Bacterial Glycerol Stock
cholesteryl ester transfer protein, plasma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1517s1c1
Sequence:CCGGCCTGAGATTATCACTCGAGATCTCGAGATCTCGAGTGATAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-739s1c1
Sequence:CCGGGATCAACGTCATCTCTAACATCTCGAGATGTTAGAGATGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-751s1c1
Sequence:CCGGCTCTAACATCATGGCCGATTTCTCGAGAAATCGGCCATGATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-877s1c1
Sequence:CCGGCAAGGGTCATTTCATCTACAACTCGAGTTGTAGATGAAATGACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1243s1c1
Sequence:CCGGCCAGCAACATTCTGTAGCTTACTCGAGTAAGCTACAGAATGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-597s21c1
Sequence:CCGGCAAGCAGCTGTTCACAAATTTCTCGAGAAATTTGTGAACAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-1500s21c1
Sequence:CCGGTGAGCACCTGCTGGTGGATTTCTCGAGAAATCCACCAGCAGGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000078
CETP MISSION shRNA shRNA Plasmid DNA
cholesteryl ester transfer protein, plasma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1517s1c1
Sequence:CCGGCCTGAGATTATCACTCGAGATCTCGAGATCTCGAGTGATAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-739s1c1
Sequence:CCGGGATCAACGTCATCTCTAACATCTCGAGATGTTAGAGATGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-751s1c1
Sequence:CCGGCTCTAACATCATGGCCGATTTCTCGAGAAATCGGCCATGATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-877s1c1
Sequence:CCGGCAAGGGTCATTTCATCTACAACTCGAGTTGTAGATGAAATGACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1243s1c1
Sequence:CCGGCCAGCAACATTCTGTAGCTTACTCGAGTAAGCTACAGAATGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-597s21c1
Sequence:CCGGCAAGCAGCTGTTCACAAATTTCTCGAGAAATTTGTGAACAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-1500s21c1
Sequence:CCGGTGAGCACCTGCTGGTGGATTTCTCGAGAAATCCACCAGCAGGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000078
CETP MISSION shRNA Lentiviral Transduction Particles
cholesteryl ester transfer protein, plasma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1517s1c1
Sequence:CCGGCCTGAGATTATCACTCGAGATCTCGAGATCTCGAGTGATAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-739s1c1
Sequence:CCGGGATCAACGTCATCTCTAACATCTCGAGATGTTAGAGATGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-751s1c1
Sequence:CCGGCTCTAACATCATGGCCGATTTCTCGAGAAATCGGCCATGATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-877s1c1
Sequence:CCGGCAAGGGTCATTTCATCTACAACTCGAGTTGTAGATGAAATGACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000078.1-1243s1c1
Sequence:CCGGCCAGCAACATTCTGTAGCTTACTCGAGTAAGCTACAGAATGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-597s21c1
Sequence:CCGGCAAGCAGCTGTTCACAAATTTCTCGAGAAATTTGTGAACAGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000078.2-1500s21c1
Sequence:CCGGTGAGCACCTGCTGGTGGATTTCTCGAGAAATCCACCAGCAGGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks