EMAIL THIS PAGE TO A FRIEND

CFB

complement factor B

61 Gene Product Result for
Synonyms: AHUS4 BF BFD CFAB FB FBI12 GBG H2-Bf PBF2
Gene ID:
Human(629) Summary: This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
Mouse(14962) complement factor B
Rat(294257) complement factor B
Zebrafish(30604) complement factor B
Horse(100051124) complement factor B
cow(514076) complement factor B
domestic cat(101093018) complement factor B
dog(100688056) complement factor B
sheep(101115072) complement factor B
domestic guinea pig(100715616) complement factor B
naked mole-rat(101725137) complement factor B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105341 MISSION® esiRNA esiRNA human AL662849.8-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001710 Rosetta Predictions human pricing
NM_212466 Rosetta Predictions rat pricing
NM_008198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080004 predicted 259
2 SASI_Hs01_00080005 predicted 1139
3 SASI_Hs01_00080006 predicted 1191
4 SASI_Hs01_00080007 predicted 1101
5 SASI_Hs01_00080008 predicted 611
6 SASI_Hs01_00080009 predicted 1870
7 SASI_Hs01_00080010 predicted 1726
8 SASI_Hs02_00332398 predicted 1578
9 SASI_Hs02_00332399 predicted 1075
10 SASI_Hs02_00332400 predicted 1312
11 SASI_Hs01_00080011 predicted 596
12 SASI_Hs01_00080012 predicted 1977
13 SASI_Hs01_00080013 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119562 predicted 1208
2 SASI_Rn02_00270465 predicted 2049
3 SASI_Rn02_00270466 predicted 1658
4 SASI_Rn01_00119563 predicted 2085
5 SASI_Rn01_00119564 predicted 1810
6 SASI_Rn02_00270467 predicted 673
7 SASI_Rn01_00119565 predicted 2116
8 SASI_Rn01_00119567 predicted 1429
9 SASI_Rn02_00270468 predicted 1709
10 SASI_Rn01_00119569 predicted 1510
11 SASI_Rn01_00119566 predicted 1879
12 SASI_Rn01_00119568 predicted 684
13 SASI_Rn01_00119570 predicted 1123
14 SASI_Rn01_00119571 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184997 predicted 619
2 SASI_Mm02_00313343 predicted 650
3 SASI_Mm01_00184999 predicted 1111
4 SASI_Mm01_00185000 predicted 1019
5 SASI_Mm01_00185001 predicted 707
6 SASI_Mm01_00185002 predicted 2093
7 SASI_Mm01_00185003 predicted 2215
8 SASI_Mm01_00185004 predicted 1560
9 SASI_Mm01_00185005 predicted 596
10 SASI_Mm02_00313344 predicted 1124
11 SASI_Mm01_00184996 predicted 1447
12 SASI_Mm01_00184998 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001710
VALIDATED
CFB MISSION shRNA Bacterial Glycerol Stock
complement factor B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1283s21c1
Sequence:CCGGCACGAAGCAGCTCAATGAAATCTCGAGATTTCATTGAGCTGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1923s21c1
Sequence:CCGGGAGATAGAAGTAGTCCTATTTCTCGAGAAATAGGACTACTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-2244s21c1
Sequence:CCGGTGTGAGAGAGATGCTCAATATCTCGAGATATTGAGCATCTCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001710.x-1067s1c1
Sequence:CCGGAGCAACTTCACAGGAGCCAAACTCGAGTTTGGCTCCTGTGAAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1570s1c1
Sequence:CCGGTGTGTTCAAAGTCAAGGATATCTCGAGATATCCTTGACTTTGAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1713s1c1
Sequence:CCGGTCTCAGTCATTCGCCCTTCAACTCGAGTTGAAGGGCGAATGACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1820s1c1
Sequence:CCGGCACTCAATCAAGGTCAGCGTACTCGAGTACGCTGACCTTGATTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-2428s1c1
Sequence:CCGGCGCCCGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001710
VALIDATED
CFB MISSION shRNA shRNA Plasmid DNA
complement factor B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1283s21c1
Sequence:CCGGCACGAAGCAGCTCAATGAAATCTCGAGATTTCATTGAGCTGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1923s21c1
Sequence:CCGGGAGATAGAAGTAGTCCTATTTCTCGAGAAATAGGACTACTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-2244s21c1
Sequence:CCGGTGTGAGAGAGATGCTCAATATCTCGAGATATTGAGCATCTCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001710.x-1067s1c1
Sequence:CCGGAGCAACTTCACAGGAGCCAAACTCGAGTTTGGCTCCTGTGAAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1570s1c1
Sequence:CCGGTGTGTTCAAAGTCAAGGATATCTCGAGATATCCTTGACTTTGAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1713s1c1
Sequence:CCGGTCTCAGTCATTCGCCCTTCAACTCGAGTTGAAGGGCGAATGACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1820s1c1
Sequence:CCGGCACTCAATCAAGGTCAGCGTACTCGAGTACGCTGACCTTGATTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-2428s1c1
Sequence:CCGGCGCCCGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001710
VALIDATED
CFB MISSION shRNA Lentiviral Transduction Particles
complement factor B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1283s21c1
Sequence:CCGGCACGAAGCAGCTCAATGAAATCTCGAGATTTCATTGAGCTGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-1923s21c1
Sequence:CCGGGAGATAGAAGTAGTCCTATTTCTCGAGAAATAGGACTACTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001710.5-2244s21c1
Sequence:CCGGTGTGAGAGAGATGCTCAATATCTCGAGATATTGAGCATCTCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001710.x-1067s1c1
Sequence:CCGGAGCAACTTCACAGGAGCCAAACTCGAGTTTGGCTCCTGTGAAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1570s1c1
Sequence:CCGGTGTGTTCAAAGTCAAGGATATCTCGAGATATCCTTGACTTTGAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1713s1c1
Sequence:CCGGTCTCAGTCATTCGCCCTTCAACTCGAGTTGAAGGGCGAATGACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-1820s1c1
Sequence:CCGGCACTCAATCAAGGTCAGCGTACTCGAGTACGCTGACCTTGATTGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001710.x-2428s1c1
Sequence:CCGGCGCCCGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008198
CFB MISSION shRNA Bacterial Glycerol Stock
complement factor B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-605s1c1
Sequence:CCGGCCGGTATTCCTATTGGGACAACTCGAGTTGTCCCAATAGGAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1845s1c1
Sequence:CCGGGCTCAAGAACAAGCTCAAGTACTCGAGTACTTGAGCTTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1241s1c1
Sequence:CCGGCCCGCCATGTCATCATCATTACTCGAGTAATGATGATGACATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1990s1c1
Sequence:CCGGGCTCTGTTTGTATCTGAGCAACTCGAGTTGCTCAGATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1024s1c1
Sequence:CCGGCGATATGGTCTCCTGACATATCTCGAGATATGTCAGGAGACCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008198
CFB MISSION shRNA shRNA Plasmid DNA
complement factor B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-605s1c1
Sequence:CCGGCCGGTATTCCTATTGGGACAACTCGAGTTGTCCCAATAGGAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1845s1c1
Sequence:CCGGGCTCAAGAACAAGCTCAAGTACTCGAGTACTTGAGCTTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1241s1c1
Sequence:CCGGCCCGCCATGTCATCATCATTACTCGAGTAATGATGATGACATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1990s1c1
Sequence:CCGGGCTCTGTTTGTATCTGAGCAACTCGAGTTGCTCAGATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1024s1c1
Sequence:CCGGCGATATGGTCTCCTGACATATCTCGAGATATGTCAGGAGACCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008198
CFB MISSION shRNA Lentiviral Transduction Particles
complement factor B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-605s1c1
Sequence:CCGGCCGGTATTCCTATTGGGACAACTCGAGTTGTCCCAATAGGAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1845s1c1
Sequence:CCGGGCTCAAGAACAAGCTCAAGTACTCGAGTACTTGAGCTTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1241s1c1
Sequence:CCGGCCCGCCATGTCATCATCATTACTCGAGTAATGATGATGACATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1990s1c1
Sequence:CCGGGCTCTGTTTGTATCTGAGCAACTCGAGTTGCTCAGATACAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008198.1-1024s1c1
Sequence:CCGGCGATATGGTCTCCTGACATATCTCGAGATATGTCAGGAGACCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks