EMAIL THIS PAGE TO A FRIEND

CFC1B

cripto, FRL-1, cryptic family 1B

53 Gene Product Result for
Species: Human CFC1B(653275), chicken CFC1B(395437)
UniProtKB ID: P0CG36, B2RCY0, B9EJD3, Q53T05, Q9GZR3
Gene ID:
chicken(395437) cripto, FRL-1, cryptic family 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305669 ANTI-CFC1B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079530 Rosetta Predictions human pricing
XM_928615 Rosetta Predictions human pricing
XM_932990 Rosetta Predictions human pricing
XM_933000 Rosetta Predictions human pricing
XM_933002 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313520 predicted 405
2 SASI_Hs02_00313521 predicted 432
3 SASI_Hs02_00313522 predicted 500
4 SASI_Hs02_00313523 predicted 717
5 SASI_Hs02_00313524 predicted 428
6 SASI_Hs02_00313525 predicted 396
7 SASI_Hs02_00313526 predicted 401
8 SASI_Hs02_00313527 predicted 741
9 SASI_Hs02_00313528 predicted 528
10 SASI_Hs02_00313529 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269441 predicted 398
2 SASI_Hs01_00269442 predicted 1108
3 SASI_Hs01_00269443 predicted 1300
4 SASI_Hs01_00269444 predicted 1037
5 SASI_Hs01_00269445 predicted 434
6 SASI_Hs01_00269446 predicted 1083
7 SASI_Hs01_00269447 predicted 420
8 SASI_Hs01_00269448 predicted 504
9 SASI_Hs01_00269449 predicted 723
10 SASI_Hs01_00269450 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265061 predicted 401
2 SASI_Hs01_00265062 predicted 431
3 SASI_Hs01_00265063 predicted 423
4 SASI_Hs01_00265064 predicted 504
5 SASI_Hs01_00265065 predicted 724
6 SASI_Hs01_00265066 predicted 538
7 SASI_Hs01_00265067 predicted 426
8 SASI_Hs01_00265068 predicted 396
9 SASI_Hs01_00265069 predicted 400
10 SASI_Hs01_00265070 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281502 predicted 398
2 SASI_Hs01_00281503 predicted 877
3 SASI_Hs01_00281504 predicted 1075
4 SASI_Hs01_00281505 predicted 812
5 SASI_Hs01_00281506 predicted 431
6 SASI_Hs01_00281507 predicted 857
7 SASI_Hs01_00281508 predicted 419
8 SASI_Hs01_00281509 predicted 502
9 SASI_Hs01_00281510 predicted 1315
10 SASI_Hs01_00281511 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266989 predicted 399
2 SASI_Hs01_00266990 predicted 989
3 SASI_Hs01_00266991 predicted 1180
4 SASI_Hs01_00266992 predicted 917
5 SASI_Hs01_00266993 predicted 427
6 SASI_Hs01_00266994 predicted 963
7 SASI_Hs01_00266995 predicted 421
8 SASI_Hs01_00266996 predicted 505
9 SASI_Hs01_00266997 predicted 1425
10 SASI_Hs01_00266998 predicted 1033
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079530
CFC1B MISSION shRNA Bacterial Glycerol Stock
cripto, FRL-1, cryptic family 1B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-558s21c1
Sequence:CCGGGTCATTTCGGAGAGGTGACTGCTCGAGCAGTCACCTCTCCGAAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-476s21c1
Sequence:CCGGGAGAAACATAACGGCGGTAGACTCGAGTCTACCGCCGTTATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-505s21c1
Sequence:CCGGCACCAAGGTTGCCACTCAGAACTCGAGTTCTGAGTGGCAACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-436s21c1
Sequence:CCGGGGCATTACAGATCATCAATTTCTCGAGAAATTGATGATCTGTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079530
CFC1B MISSION shRNA shRNA Plasmid DNA
cripto, FRL-1, cryptic family 1B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-558s21c1
Sequence:CCGGGTCATTTCGGAGAGGTGACTGCTCGAGCAGTCACCTCTCCGAAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-476s21c1
Sequence:CCGGGAGAAACATAACGGCGGTAGACTCGAGTCTACCGCCGTTATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-505s21c1
Sequence:CCGGCACCAAGGTTGCCACTCAGAACTCGAGTTCTGAGTGGCAACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-436s21c1
Sequence:CCGGGGCATTACAGATCATCAATTTCTCGAGAAATTGATGATCTGTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079530
CFC1B MISSION shRNA Lentiviral Transduction Particles
cripto, FRL-1, cryptic family 1B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-558s21c1
Sequence:CCGGGTCATTTCGGAGAGGTGACTGCTCGAGCAGTCACCTCTCCGAAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-476s21c1
Sequence:CCGGGAGAAACATAACGGCGGTAGACTCGAGTCTACCGCCGTTATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-505s21c1
Sequence:CCGGCACCAAGGTTGCCACTCAGAACTCGAGTTCTGAGTGGCAACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079530.1-436s21c1
Sequence:CCGGGGCATTACAGATCATCAATTTCTCGAGAAATTGATGATCTGTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks