EMAIL THIS PAGE TO A FRIEND

CFD

complement factor D (adipsin)

50 Gene Product Result for
Synonyms: ADIPSIN ADN DF PFD
UniProtKB ID: P00746, B4DV76, Q5U5S1, Q86VJ5, Q8N4E0, Q8WZB4
Gene ID:
Human(1675) Summary: The protein encoded by this gene is a member of the trypsin family of peptidases. The encoded protein is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Finally, the encoded protein has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. [provided by RefSeq, Jul 2008]
Mouse(11537) complement factor D (adipsin)
Rat(54249) complement factor D (adipsin)
Zebrafish(553553) complement factor D (adipsin)
dog(485095) complement factor D (adipsin)
cow(505647) complement factor D (adipsin)
domestic cat(101093500) complement factor D (adipsin)
chicken(100857593) complement factor D (adipsin)
naked mole-rat(101721935) complement factor D (adipsin)
domestic guinea pig(100724693) complement factor D (adipsin)
sheep(101115705) complement factor D (adipsin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301593 ANTI-CFD (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2107503 Anti-CFD antibody produced in rabbit affinity isolated antibody human, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001928 Rosetta Predictions human pricing
NM_001077642 Rosetta Predictions rat pricing
NM_013459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121747 predicted 373
2 SASI_Hs02_00332822 predicted 582
3 SASI_Hs01_00121750 predicted 285
4 SASI_Hs01_00121752 predicted 440
5 SASI_Hs02_00332823 predicted 578
6 SASI_Hs02_00332824 predicted 434
7 SASI_Hs02_00332825 predicted 227
8 SASI_Hs02_00332826 predicted 578
9 SASI_Hs01_00121755 predicted 585
10 SASI_Hs01_00121756 predicted 236
11 SASI_Hs01_00121748 predicted 628
12 SASI_Hs01_00121749 predicted 590
13 SASI_Hs01_00121751 predicted 351
14 SASI_Hs01_00121753 predicted 424
15 SASI_Hs01_00121754 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207652 predicted 264
2 SASI_Rn02_00207653 predicted 529
3 SASI_Rn02_00207654 predicted 279
4 SASI_Rn02_00207655 predicted 582
5 SASI_Rn02_00207656 predicted 489
6 SASI_Rn02_00207657 predicted 497
7 SASI_Rn02_00207658 predicted 272
8 SASI_Rn02_00207659 predicted 269
9 SASI_Rn02_00207660 predicted 277
10 SASI_Rn02_00207661 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175385 predicted 279
2 SASI_Mm01_00175386 predicted 541
3 SASI_Mm01_00175387 predicted 292
4 SASI_Mm01_00175388 predicted 501
5 SASI_Mm01_00175389 predicted 292
6 SASI_Mm01_00175390 predicted 520
7 SASI_Mm01_00175391 predicted 601
8 SASI_Mm01_00175392 predicted 511
9 SASI_Mm02_00322063 predicted 413
10 SASI_Mm01_00175393 predicted 515
11 SASI_Mm01_00175394 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001928
VALIDATED
CFD MISSION shRNA Bacterial Glycerol Stock
complement factor D (adipsin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-917s21c1
Sequence:CCGGATCATTGGATCTCAGGAGTTCCTCGAGGAACTCCTGAGATCCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-832s21c1
Sequence:CCGGCGAGCAATGAAGTCATCCACTCTCGAGAGTGGATGACTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-808s21c1
Sequence:CCGGAGGGTCACCCAAGCAACAAAGCTCGAGCTTTGTTGCTTGGGTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-855s21c1
Sequence:CCGGTGCATCTGGTTGGTCTTTATTCTCGAGAATAAAGACCAACCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-960s1c1
Sequence:CCGGCGCGACTCCATCTCTACAAATCTCGAGATTTGTAGAGATGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-239s1c1
Sequence:CCGGGCCGACGGGAAGGTGCAGGTTCTCGAGAACCTGCACCTTCCCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-706s1c1
Sequence:CCGGCGTTTGCGGCAACCGCAAGAACTCGAGTTCTTGCGGTTGCCGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-595s1c1
Sequence:CCGGCGAGCGCTTGATGTGCGCGGACTCGAGTCCGCGCACATCAAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001928
VALIDATED
CFD MISSION shRNA shRNA Plasmid DNA
complement factor D (adipsin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-917s21c1
Sequence:CCGGATCATTGGATCTCAGGAGTTCCTCGAGGAACTCCTGAGATCCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-832s21c1
Sequence:CCGGCGAGCAATGAAGTCATCCACTCTCGAGAGTGGATGACTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-808s21c1
Sequence:CCGGAGGGTCACCCAAGCAACAAAGCTCGAGCTTTGTTGCTTGGGTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-855s21c1
Sequence:CCGGTGCATCTGGTTGGTCTTTATTCTCGAGAATAAAGACCAACCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-960s1c1
Sequence:CCGGCGCGACTCCATCTCTACAAATCTCGAGATTTGTAGAGATGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-239s1c1
Sequence:CCGGGCCGACGGGAAGGTGCAGGTTCTCGAGAACCTGCACCTTCCCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-706s1c1
Sequence:CCGGCGTTTGCGGCAACCGCAAGAACTCGAGTTCTTGCGGTTGCCGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-595s1c1
Sequence:CCGGCGAGCGCTTGATGTGCGCGGACTCGAGTCCGCGCACATCAAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001928
VALIDATED
CFD MISSION shRNA Lentiviral Transduction Particles
complement factor D (adipsin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-917s21c1
Sequence:CCGGATCATTGGATCTCAGGAGTTCCTCGAGGAACTCCTGAGATCCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-832s21c1
Sequence:CCGGCGAGCAATGAAGTCATCCACTCTCGAGAGTGGATGACTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-808s21c1
Sequence:CCGGAGGGTCACCCAAGCAACAAAGCTCGAGCTTTGTTGCTTGGGTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001928.2-855s21c1
Sequence:CCGGTGCATCTGGTTGGTCTTTATTCTCGAGAATAAAGACCAACCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-960s1c1
Sequence:CCGGCGCGACTCCATCTCTACAAATCTCGAGATTTGTAGAGATGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-239s1c1
Sequence:CCGGGCCGACGGGAAGGTGCAGGTTCTCGAGAACCTGCACCTTCCCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001928.2-706s1c1
Sequence:CCGGCGTTTGCGGCAACCGCAAGAACTCGAGTTCTTGCGGTTGCCGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001928.2-595s1c1
Sequence:CCGGCGAGCGCTTGATGTGCGCGGACTCGAGTCCGCGCACATCAAGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013459
CFD MISSION shRNA Bacterial Glycerol Stock
complement factor D (adipsin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-664s1c1
Sequence:CCGGATGCAGTCGAAGGTGTGGTTACTCGAGTAACCACACCTTCGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-417s1c1
Sequence:CCGGCCCTTGCAATACGAGGACAAACTCGAGTTTGTCCTCGTATTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-282s1c1
Sequence:CCGGGAACCCTACAAGCGATGGTATCTCGAGATACCATCGCTTGTAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-518s1c1
Sequence:CCGGTCAACTCAGAGTGTCAATCATCTCGAGATGATTGACACTCTGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-294s1c1
Sequence:CCGGCGATGGTATGATGTGCAGAGTCTCGAGACTCTGCACATCATACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013459
CFD MISSION shRNA shRNA Plasmid DNA
complement factor D (adipsin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-664s1c1
Sequence:CCGGATGCAGTCGAAGGTGTGGTTACTCGAGTAACCACACCTTCGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-417s1c1
Sequence:CCGGCCCTTGCAATACGAGGACAAACTCGAGTTTGTCCTCGTATTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-282s1c1
Sequence:CCGGGAACCCTACAAGCGATGGTATCTCGAGATACCATCGCTTGTAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-518s1c1
Sequence:CCGGTCAACTCAGAGTGTCAATCATCTCGAGATGATTGACACTCTGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-294s1c1
Sequence:CCGGCGATGGTATGATGTGCAGAGTCTCGAGACTCTGCACATCATACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013459
CFD MISSION shRNA Lentiviral Transduction Particles
complement factor D (adipsin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-664s1c1
Sequence:CCGGATGCAGTCGAAGGTGTGGTTACTCGAGTAACCACACCTTCGACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-417s1c1
Sequence:CCGGCCCTTGCAATACGAGGACAAACTCGAGTTTGTCCTCGTATTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-282s1c1
Sequence:CCGGGAACCCTACAAGCGATGGTATCTCGAGATACCATCGCTTGTAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-518s1c1
Sequence:CCGGTCAACTCAGAGTGTCAATCATCTCGAGATGATTGACACTCTGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013459.1-294s1c1
Sequence:CCGGCGATGGTATGATGTGCAGAGTCTCGAGACTCTGCACATCATACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks