EMAIL THIS PAGE TO A FRIEND

CFDP1

craniofacial development protein 1

Synonyms: BCNT BUCENTAUR CENP-29 CP27 SWC5 Yeti p97
UniProtKB ID: Q9UEE9, O00393, O00404, Q9UEF0, Q9UEF1, Q9UEF8
Gene ID:
Mouse(23837) craniofacial development protein 1
Rat(292027) craniofacial development protein 1
sheep(101116755) craniofacial development protein 1
domestic guinea pig(100736218) craniofacial development protein 1
naked mole-rat(101709349) craniofacial development protein 1
Zebrafish(553312) CFDP1 protein
dog(403675) craniofacial development protein 1
cow(281682) craniofacial development protein 1
domestic cat(101091419) craniofacial development protein 1
chicken(374073) craniofacial development protein 1
Gene Class: Apoptosis
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006324 Rosetta Predictions human pricing
NM_199378 Rosetta Predictions rat pricing
NM_011801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044190 predicted 850
2 SASI_Hs01_00044191 predicted 651
3 SASI_Hs01_00044193 predicted 561
4 SASI_Hs01_00044194 predicted 371
5 SASI_Hs02_00341353 predicted 913
6 SASI_Hs01_00044195 predicted 322
7 SASI_Hs01_00044196 predicted 482
8 SASI_Hs01_00044198 predicted 921
9 SASI_Hs01_00044199 predicted 212
10 SASI_Hs02_00341354 predicted 471
11 SASI_Hs01_00044192 predicted 745
12 SASI_Hs01_00044197 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039795 predicted 881
2 SASI_Rn01_00039796 predicted 683
3 SASI_Rn01_00039797 predicted 223
4 SASI_Rn01_00039799 predicted 575
5 SASI_Rn01_00039800 predicted 469
6 SASI_Rn01_00039801 predicted 517
7 SASI_Rn01_00039802 predicted 457
8 SASI_Rn01_00039803 predicted 719
9 SASI_Rn01_00039804 predicted 530
10 SASI_Rn02_00270188 predicted 889
11 SASI_Rn01_00039798 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138700 predicted 648
2 SASI_Mm01_00138702 predicted 748
3 SASI_Mm01_00138703 predicted 621
4 SASI_Mm01_00138704 predicted 508
5 SASI_Mm02_00321478 predicted 505
6 SASI_Mm01_00138705 predicted 593
7 SASI_Mm01_00138707 predicted 572
8 SASI_Mm01_00138708 predicted 518
9 SASI_Mm01_00138709 predicted 890
10 SASI_Mm02_00321479 predicted 641
11 SASI_Mm01_00138701 predicted 444
12 SASI_Mm01_00138706 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006324
VALIDATED
CFDP1 MISSION shRNA Bacterial Glycerol Stock
craniofacial development protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-215s1c1
Sequence:CCGGGAAGATGAAGTGGATGGTGAACTCGAGTTCACCATCCACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-627s1c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-310s1c1
Sequence:CCGGCCTCTCATTAGAAGAAGAGGACTCGAGTCCTCTTCTTCTAATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-962s1c1
Sequence:CCGGCAGTTTGAAATTGAGCGAGATCTCGAGATCTCGCTCAATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-877s1c1
Sequence:CCGGGATTGGTGAAGAACTGGCCATCTCGAGATGGCCAGTTCTTCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-676s1c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-961s1c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-655s21c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1032s21c1
Sequence:CCGGCCTTGATGTTACGGGCTAAATCTCGAGATTTAGCCCGTAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-704s21c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1055s21c1
Sequence:CCGGAGAGCAGCTTAATCCTGTTTACTCGAGTAAACAGGATTAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-989s21c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006324
VALIDATED
CFDP1 MISSION shRNA shRNA Plasmid DNA
craniofacial development protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-215s1c1
Sequence:CCGGGAAGATGAAGTGGATGGTGAACTCGAGTTCACCATCCACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-627s1c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-310s1c1
Sequence:CCGGCCTCTCATTAGAAGAAGAGGACTCGAGTCCTCTTCTTCTAATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-962s1c1
Sequence:CCGGCAGTTTGAAATTGAGCGAGATCTCGAGATCTCGCTCAATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-877s1c1
Sequence:CCGGGATTGGTGAAGAACTGGCCATCTCGAGATGGCCAGTTCTTCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-676s1c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-961s1c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-655s21c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1032s21c1
Sequence:CCGGCCTTGATGTTACGGGCTAAATCTCGAGATTTAGCCCGTAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-704s21c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1055s21c1
Sequence:CCGGAGAGCAGCTTAATCCTGTTTACTCGAGTAAACAGGATTAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-989s21c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006324
VALIDATED
CFDP1 MISSION shRNA Lentiviral Transduction Particles
craniofacial development protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-215s1c1
Sequence:CCGGGAAGATGAAGTGGATGGTGAACTCGAGTTCACCATCCACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-627s1c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006324.1-310s1c1
Sequence:CCGGCCTCTCATTAGAAGAAGAGGACTCGAGTCCTCTTCTTCTAATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006324.1-962s1c1
Sequence:CCGGCAGTTTGAAATTGAGCGAGATCTCGAGATCTCGCTCAATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-877s1c1
Sequence:CCGGGATTGGTGAAGAACTGGCCATCTCGAGATGGCCAGTTCTTCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-676s1c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006324.1-961s1c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-655s21c1
Sequence:CCGGGTGAAGAAGTAAGGGTAACTACTCGAGTAGTTACCCTTACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1032s21c1
Sequence:CCGGCCTTGATGTTACGGGCTAAATCTCGAGATTTAGCCCGTAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-704s21c1
Sequence:CCGGCAAATCCTTCTTCAAGCAGAACTCGAGTTCTGCTTGAAGAAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-1055s21c1
Sequence:CCGGAGAGCAGCTTAATCCTGTTTACTCGAGTAAACAGGATTAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006324.2-989s21c1
Sequence:CCGGGCAGTTTGAAATTGAGCGAGACTCGAGTCTCGCTCAATTTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011801
VALIDATED
CFDP1 MISSION shRNA Bacterial Glycerol Stock
craniofacial development protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011801.1-1041s1c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-610s1c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-498s1c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-609s1c1
Sequence:CCGGGCGAAGAAGTAAGGGTGACTACTCGAGTAGTCACCCTTACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-896s1c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-896s21c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011801.1-1041s21c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-498s21c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-610s21c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011801
VALIDATED
CFDP1 MISSION shRNA shRNA Plasmid DNA
craniofacial development protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011801.1-1041s1c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-610s1c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-498s1c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-609s1c1
Sequence:CCGGGCGAAGAAGTAAGGGTGACTACTCGAGTAGTCACCCTTACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-896s1c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-896s21c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011801.1-1041s21c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-498s21c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-610s21c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011801
VALIDATED
CFDP1 MISSION shRNA Lentiviral Transduction Particles
craniofacial development protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011801.1-1041s1c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-610s1c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-498s1c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011801.1-609s1c1
Sequence:CCGGGCGAAGAAGTAAGGGTGACTACTCGAGTAGTCACCCTTACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011801.1-896s1c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-896s21c1
Sequence:CCGGGAAGGGTACATTGAGCGGAAACTCGAGTTTCCGCTCAATGTACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011801.1-1041s21c1
Sequence:CCGGCCTCTGAGTGTCTGTGAAATACTCGAGTATTTCACAGACACTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-498s21c1
Sequence:CCGGCCGAGGAGACTGAAGAGATTACTCGAGTAATCTCTTCAGTCTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011801.1-610s21c1
Sequence:CCGGCGAAGAAGTAAGGGTGACTAACTCGAGTTAGTCACCCTTACTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks