EMAIL THIS PAGE TO A FRIEND

CFH

complement factor H

69 Gene Product Result for
Synonyms: AHUS1 AMBP1 ARMD4 ARMS1 CFHL3 FH FHL1 HF HF1 HF2 HUS
Gene ID:
Human(3075) Summary: This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
Mouse(12628) complement component factor h
Rat(155012) complement factor H
Zebrafish(553297) complement factor H
chicken(429057) complement factor H
dog(478952) complement factor H
cow(280816) complement factor H
Horse(100051358) complement factor H
naked mole-rat(101715308) complement factor H
domestic guinea pig(100733902) complement factor H
sheep(100174982) complement factor H
Domestic Rabbit(100340175) complement factor H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000186 Rosetta Predictions human pricing
NM_001014975 Rosetta Predictions human pricing
NM_130409 Rosetta Predictions rat pricing
NM_009888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054332 predicted 449
2 SASI_Hs01_00054333 predicted 631
3 SASI_Hs01_00054334 predicted 445
4 SASI_Hs01_00054335 predicted 873
5 SASI_Hs01_00054337 predicted 1091
6 SASI_Hs01_00054338 predicted 1171
7 SASI_Hs02_00302032 predicted 295
8 SASI_Hs01_00054339 predicted 635
9 SASI_Hs02_00302033 predicted 530
10 SASI_Hs01_00054341 predicted 599
11 SASI_Hs01_00054336 predicted 911
12 SASI_Hs01_00054340 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210853 predicted 450
2 SASI_Hs01_00210854 predicted 629
3 SASI_Hs01_00210855 predicted 438
4 SASI_Hs01_00210856 predicted 880
5 SASI_Hs01_00210858 predicted 1097
6 SASI_Hs01_00210859 predicted 1175
7 SASI_Hs02_00306597 predicted 293
8 SASI_Hs01_00210860 predicted 636
9 SASI_Hs02_00306598 predicted 530
10 SASI_Hs01_00210862 predicted 598
11 SASI_Hs01_00210857 predicted 919
12 SASI_Hs01_00210861 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089482 predicted 395
2 SASI_Rn02_00267399 predicted 836
3 SASI_Rn02_00267400 predicted 936
4 SASI_Rn01_00089484 predicted 269
5 SASI_Rn02_00267401 predicted 2207
6 SASI_Rn01_00089486 predicted 407
7 SASI_Rn01_00089487 predicted 2728
8 SASI_Rn01_00089488 predicted 2739
9 SASI_Rn02_00267402 predicted 1431
10 SASI_Rn01_00089489 predicted 1221
11 SASI_Rn01_00089481 predicted 1681
12 SASI_Rn01_00089483 predicted 3760
13 SASI_Rn01_00089485 predicted 3731
14 SASI_Rn01_00089490 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317377 predicted 531
2 SASI_Mm02_00317378 predicted 3744
3 SASI_Mm02_00317379 predicted 2582
4 SASI_Mm02_00317380 predicted 869
5 SASI_Mm02_00317381 predicted 545
6 SASI_Mm02_00317382 predicted 3411
7 SASI_Mm02_00317383 predicted 279
8 SASI_Mm02_00317384 predicted 1083
9 SASI_Mm02_00317385 predicted 1072
10 SASI_Mm02_00317386 predicted 3104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000186
VALIDATED
CFH MISSION shRNA Bacterial Glycerol Stock
complement factor H
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2910s21c1
Sequence:CCGGTTATGCACATGGGACTAAATTCTCGAGAATTTAGTCCCATGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-1069s21c1
Sequence:CCGGTACTCACCTTTAAGGATTAAACTCGAGTTTAATCCTTAAAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2229s21c1
Sequence:CCGGTCTAATGAAGGGACCTAATAACTCGAGTTATTAGGTCCCTTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1817s1c1
Sequence:CCGGCGCAAGAAAGACCAGTATAAACTCGAGTTTATACTGGTCTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-290s1c1
Sequence:CCGGGCTCTTAATCCATTAAGGAAACTCGAGTTTCCTTAATGGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1022s1c1
Sequence:CCGGGCTCCGAGATGTACCTTGAAACTCGAGTTTCAAGGTACATCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-2876s1c1
Sequence:CCGGCCTGAGATTTCTCATGGTGTTCTCGAGAACACCATGAGAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-3152s1c1
Sequence:CCGGGCCAGTAATGTAACATGCATTCTCGAGAATGCATGTTACATTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000186
VALIDATED
CFH MISSION shRNA shRNA Plasmid DNA
complement factor H
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2910s21c1
Sequence:CCGGTTATGCACATGGGACTAAATTCTCGAGAATTTAGTCCCATGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-1069s21c1
Sequence:CCGGTACTCACCTTTAAGGATTAAACTCGAGTTTAATCCTTAAAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2229s21c1
Sequence:CCGGTCTAATGAAGGGACCTAATAACTCGAGTTATTAGGTCCCTTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1817s1c1
Sequence:CCGGCGCAAGAAAGACCAGTATAAACTCGAGTTTATACTGGTCTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-290s1c1
Sequence:CCGGGCTCTTAATCCATTAAGGAAACTCGAGTTTCCTTAATGGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1022s1c1
Sequence:CCGGGCTCCGAGATGTACCTTGAAACTCGAGTTTCAAGGTACATCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-2876s1c1
Sequence:CCGGCCTGAGATTTCTCATGGTGTTCTCGAGAACACCATGAGAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-3152s1c1
Sequence:CCGGGCCAGTAATGTAACATGCATTCTCGAGAATGCATGTTACATTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000186
VALIDATED
CFH MISSION shRNA Lentiviral Transduction Particles
complement factor H
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2910s21c1
Sequence:CCGGTTATGCACATGGGACTAAATTCTCGAGAATTTAGTCCCATGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-1069s21c1
Sequence:CCGGTACTCACCTTTAAGGATTAAACTCGAGTTTAATCCTTAAAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000186.3-2229s21c1
Sequence:CCGGTCTAATGAAGGGACCTAATAACTCGAGTTATTAGGTCCCTTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1817s1c1
Sequence:CCGGCGCAAGAAAGACCAGTATAAACTCGAGTTTATACTGGTCTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-290s1c1
Sequence:CCGGGCTCTTAATCCATTAAGGAAACTCGAGTTTCCTTAATGGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000186.1-1022s1c1
Sequence:CCGGGCTCCGAGATGTACCTTGAAACTCGAGTTTCAAGGTACATCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-2876s1c1
Sequence:CCGGCCTGAGATTTCTCATGGTGTTCTCGAGAACACCATGAGAAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000186.1-3152s1c1
Sequence:CCGGGCCAGTAATGTAACATGCATTCTCGAGAATGCATGTTACATTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009888
CFH MISSION shRNA Bacterial Glycerol Stock
complement factor H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-326s1c1
Sequence:CCGGCCATCCAGGATATGTCGGAAACTCGAGTTTCCGACATATCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-204s1c1
Sequence:CCGGGCTCGTGGTCAGAACAACTATCTCGAGATAGTTGTTCTGACCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-642s1c1
Sequence:CCGGGCTTCAAGATTGAAGGACATACTCGAGTATGTCCTTCAATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-773s1c1
Sequence:CCGGCCAGTTTACAAGGAGAATGAACTCGAGTTCATTCTCCTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-3017s1c1
Sequence:CCGGCCAGCATTTATTATATGCGAACTCGAGTTCGCATATAATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009888
CFH MISSION shRNA shRNA Plasmid DNA
complement factor H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-326s1c1
Sequence:CCGGCCATCCAGGATATGTCGGAAACTCGAGTTTCCGACATATCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-204s1c1
Sequence:CCGGGCTCGTGGTCAGAACAACTATCTCGAGATAGTTGTTCTGACCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-642s1c1
Sequence:CCGGGCTTCAAGATTGAAGGACATACTCGAGTATGTCCTTCAATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-773s1c1
Sequence:CCGGCCAGTTTACAAGGAGAATGAACTCGAGTTCATTCTCCTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-3017s1c1
Sequence:CCGGCCAGCATTTATTATATGCGAACTCGAGTTCGCATATAATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009888
CFH MISSION shRNA Lentiviral Transduction Particles
complement factor H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-326s1c1
Sequence:CCGGCCATCCAGGATATGTCGGAAACTCGAGTTTCCGACATATCCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-204s1c1
Sequence:CCGGGCTCGTGGTCAGAACAACTATCTCGAGATAGTTGTTCTGACCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-642s1c1
Sequence:CCGGGCTTCAAGATTGAAGGACATACTCGAGTATGTCCTTCAATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-773s1c1
Sequence:CCGGCCAGTTTACAAGGAGAATGAACTCGAGTTCATTCTCCTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009888.2-3017s1c1
Sequence:CCGGCCAGCATTTATTATATGCGAACTCGAGTTCGCATATAATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks