EMAIL THIS PAGE TO A FRIEND

CFHR1

complement factor H-related 1

67 Gene Product Result for
Synonyms: CFHL CFHL1 CFHL1P CFHR1P FHR1 H36-1 H36-2 HFL1 HFL2
UniProtKB ID: Q03591, A8K465, Q3B774, Q9UJ17
Gene ID:
Human(3078) Summary: This gene encodes a secreted protein belonging to the complement factor H protein family. It binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. It is proposed that Tuf acts as a virulence factor by acquiring host proteins to the pathogen surface, controlling complement, and facilitating tissue invasion. Mutations in this gene are associated with an increased risk of atypical hemolytic-uremic syndrome. [provided by RefSeq, Oct 2009]
Mouse(50702) complement factor H-related 1
Rat(289057) complement factor H-related 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0492 AQUA Peptide INHGILYDEE[K] human pricing
AQ0493 AQUA Peptide TGESAEFV(CM-Cys)[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115071 MISSION® esiRNA esiRNA human CFHR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002113 Rosetta Predictions human pricing
NM_001044227 Rosetta Predictions rat pricing
XM_222695 Rosetta Predictions rat pricing
NM_015780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041698 predicted 901
2 SASI_Hs01_00041699 predicted 895
3 SASI_Hs02_00333231 predicted 574
4 SASI_Hs01_00041701 predicted 850
5 SASI_Hs01_00041702 predicted 756
6 SASI_Hs01_00041703 predicted 553
7 SASI_Hs01_00041705 predicted 838
8 SASI_Hs01_00041706 predicted 806
9 SASI_Hs02_00333232 predicted 603
10 SASI_Hs02_00333233 predicted 597
11 SASI_Hs01_00041697 predicted 684
12 SASI_Hs01_00041700 predicted 548
13 SASI_Hs01_00041704 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204997 predicted 367
2 SASI_Rn02_00204998 predicted 861
3 SASI_Rn02_00204999 predicted 366
4 SASI_Rn02_00205000 predicted 865
5 SASI_Rn02_00205001 predicted 863
6 SASI_Rn02_00205002 predicted 358
7 SASI_Rn02_00205003 predicted 244
8 SASI_Rn02_00205004 predicted 262
9 SASI_Rn02_00205005 predicted 237
10 SASI_Rn02_00205006 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193530 predicted 630
2 SASI_Rn01_00193531 predicted 638
3 SASI_Rn01_00193532 predicted 598
4 SASI_Rn01_00193533 predicted 332
5 SASI_Rn01_00193534 predicted 388
6 SASI_Rn01_00193535 predicted 945
7 SASI_Rn01_00193536 predicted 677
8 SASI_Rn01_00193537 predicted 158
9 SASI_Rn01_00193538 predicted 373
10 SASI_Rn01_00193539 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323126 predicted 861
2 SASI_Mm01_00090479 predicted 794
3 SASI_Mm01_00090480 predicted 775
4 SASI_Mm01_00090481 predicted 206
5 SASI_Mm02_00323127 predicted 566
6 SASI_Mm02_00323128 predicted 569
7 SASI_Mm01_00090482 predicted 259
8 SASI_Mm02_00323129 predicted 567
9 SASI_Mm01_00090483 predicted 102
10 SASI_Mm01_00090484 predicted 113
11 SASI_Mm01_00090485 predicted 983
12 SASI_Mm01_00090486 predicted 84
13 SASI_Mm01_00090487 predicted 99
14 SASI_Mm01_00090488 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015780
CFHR1 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015780.1-1476s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-126s1c1
Sequence:CCGGCCAAAGGTGAAGTGAGCCTTTCTCGAGAAAGGCTCACTTCACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-322s1c1
Sequence:CCGGGAAGTGTCTCAGGCTATGCTTCTCGAGAAGCATAGCCTGAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-1044s1c1
Sequence:CCGGGTCACATCAATTATCCCACTTCTCGAGAAGTGGGATAATTGATGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-210s1c1
Sequence:CCGGCTGTTCTTAGTGGGAAGATTTCTCGAGAAATCTTCCCACTAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-469s21c1
Sequence:CCGGTGAAGAGGGCTGGTCCATTACCTCGAGGTAATGGACCAGCCCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-232s21c1
Sequence:CCGGATACTACTCCTGTGAATATAACTCGAGTTATATTCACAGGAGTAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-954s21c1
Sequence:CCGGTTCAGTCAGGAGAGGATATTGCTCGAGCAATATCCTCTCCTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015780
CFHR1 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015780.1-1476s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-126s1c1
Sequence:CCGGCCAAAGGTGAAGTGAGCCTTTCTCGAGAAAGGCTCACTTCACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-322s1c1
Sequence:CCGGGAAGTGTCTCAGGCTATGCTTCTCGAGAAGCATAGCCTGAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-1044s1c1
Sequence:CCGGGTCACATCAATTATCCCACTTCTCGAGAAGTGGGATAATTGATGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-210s1c1
Sequence:CCGGCTGTTCTTAGTGGGAAGATTTCTCGAGAAATCTTCCCACTAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-469s21c1
Sequence:CCGGTGAAGAGGGCTGGTCCATTACCTCGAGGTAATGGACCAGCCCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-232s21c1
Sequence:CCGGATACTACTCCTGTGAATATAACTCGAGTTATATTCACAGGAGTAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-954s21c1
Sequence:CCGGTTCAGTCAGGAGAGGATATTGCTCGAGCAATATCCTCTCCTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015780
CFHR1 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015780.1-1476s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-126s1c1
Sequence:CCGGCCAAAGGTGAAGTGAGCCTTTCTCGAGAAAGGCTCACTTCACCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-322s1c1
Sequence:CCGGGAAGTGTCTCAGGCTATGCTTCTCGAGAAGCATAGCCTGAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-1044s1c1
Sequence:CCGGGTCACATCAATTATCCCACTTCTCGAGAAGTGGGATAATTGATGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015780.1-210s1c1
Sequence:CCGGCTGTTCTTAGTGGGAAGATTTCTCGAGAAATCTTCCCACTAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-469s21c1
Sequence:CCGGTGAAGAGGGCTGGTCCATTACCTCGAGGTAATGGACCAGCCCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-232s21c1
Sequence:CCGGATACTACTCCTGTGAATATAACTCGAGTTATATTCACAGGAGTAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015780.2-954s21c1
Sequence:CCGGTTCAGTCAGGAGAGGATATTGCTCGAGCAATATCCTCTCCTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002113
CFHR1 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-390s1c1
Sequence:CCGGCTGGAAGGTGATACTGTGCAACTCGAGTTGCACAGTATCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-804s1c1
Sequence:CCGGCTTGAGGGTAACAAGCGAATACTCGAGTATTCGCTTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-552s1c1
Sequence:CCGGGTGTCGAGACAGATGAGTAAACTCGAGTTTACTCATCTGTCTCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-939s1c1
Sequence:CCGGCTTTATTTGAGAACAGGTGAACTCGAGTTCACCTGTTCTCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-766s1c1
Sequence:CCGGCTTCATCAGTTGAGTACCAATCTCGAGATTGGTACTCAACTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-583s1c1
Sequence:CCGGGTGAGAGAGTACGTTATCAATCTCGAGATTGATAACGTACTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-630s1c1
Sequence:CCGGGATGAAGAAGTGATGTGTTTACTCGAGTAAACACATCACTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-282s1c1
Sequence:CCGGCGCATAACATGCACAGAAGAACTCGAGTTCTTCTGTGCATGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-871s1c1
Sequence:CCGGCGTGTGTAATATCCCGAGAAACTCGAGTTTCTCGGGATATTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002113
CFHR1 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-390s1c1
Sequence:CCGGCTGGAAGGTGATACTGTGCAACTCGAGTTGCACAGTATCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-804s1c1
Sequence:CCGGCTTGAGGGTAACAAGCGAATACTCGAGTATTCGCTTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-552s1c1
Sequence:CCGGGTGTCGAGACAGATGAGTAAACTCGAGTTTACTCATCTGTCTCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-939s1c1
Sequence:CCGGCTTTATTTGAGAACAGGTGAACTCGAGTTCACCTGTTCTCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-766s1c1
Sequence:CCGGCTTCATCAGTTGAGTACCAATCTCGAGATTGGTACTCAACTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-583s1c1
Sequence:CCGGGTGAGAGAGTACGTTATCAATCTCGAGATTGATAACGTACTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-630s1c1
Sequence:CCGGGATGAAGAAGTGATGTGTTTACTCGAGTAAACACATCACTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-282s1c1
Sequence:CCGGCGCATAACATGCACAGAAGAACTCGAGTTCTTCTGTGCATGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-871s1c1
Sequence:CCGGCGTGTGTAATATCCCGAGAAACTCGAGTTTCTCGGGATATTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002113
CFHR1 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-390s1c1
Sequence:CCGGCTGGAAGGTGATACTGTGCAACTCGAGTTGCACAGTATCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-804s1c1
Sequence:CCGGCTTGAGGGTAACAAGCGAATACTCGAGTATTCGCTTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-552s1c1
Sequence:CCGGGTGTCGAGACAGATGAGTAAACTCGAGTTTACTCATCTGTCTCGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-939s1c1
Sequence:CCGGCTTTATTTGAGAACAGGTGAACTCGAGTTCACCTGTTCTCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-766s1c1
Sequence:CCGGCTTCATCAGTTGAGTACCAATCTCGAGATTGGTACTCAACTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-583s1c1
Sequence:CCGGGTGAGAGAGTACGTTATCAATCTCGAGATTGATAACGTACTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-630s1c1
Sequence:CCGGGATGAAGAAGTGATGTGTTTACTCGAGTAAACACATCACTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-282s1c1
Sequence:CCGGCGCATAACATGCACAGAAGAACTCGAGTTCTTCTGTGCATGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002113.1-871s1c1
Sequence:CCGGCGTGTGTAATATCCCGAGAAACTCGAGTTTCTCGGGATATTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks