EMAIL THIS PAGE TO A FRIEND

CFHR2

complement factor H-related 2

33 Gene Product Result for
Synonyms: CFHL2 FHR2 HFL3
UniProtKB ID: P36980, Q14310, Q5T9T1
Gene ID:
Mouse(545366) complement factor H-related 2
sheep(101123223) complement factor H-related 2
domestic cat(101091337) complement factor H-related 2
cow(519737) complement factor H-related 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0492 AQUA Peptide INHGILYDEE[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104841 MISSION® esiRNA esiRNA human CFHR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005666 Rosetta Predictions human pricing
NM_001025575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154924 predicted 632
2 SASI_Hs01_00154925 predicted 483
3 SASI_Hs01_00154927 predicted 679
4 SASI_Hs01_00154928 predicted 688
5 SASI_Hs01_00154926 predicted 327
6 SASI_Hs01_00154930 predicted 820
7 SASI_Hs01_00154931 predicted 859
8 SASI_Hs01_00154932 predicted 882
9 SASI_Hs01_00154933 predicted 126
10 SASI_Hs02_00340044 predicted 800
11 SASI_Hs01_00154929 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092787 predicted 803
2 SASI_Mm02_00287923 predicted 863
3 SASI_Mm01_00092788 predicted 202
4 SASI_Mm01_00092789 predicted 398
5 SASI_Mm02_00287924 predicted 1062
6 SASI_Mm02_00287925 predicted 218
7 SASI_Mm01_00092790 predicted 1053
8 SASI_Mm02_00287926 predicted 1091
9 SASI_Mm01_00092791 predicted 191
10 SASI_Mm02_00287927 predicted 163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005666
CFHR2 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-825s21c1
Sequence:CCGGTCTCATTCATTTCGAGCAATGCTCGAGCATTGCTCGAAATGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-849s21c1
Sequence:CCGGCAGAATGGGAAACTGGTATATCTCGAGATATACCAGTTTCCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-774s21c1
Sequence:CCGGACAGGTGACATAGTTGAATTTCTCGAGAAATTCAACTATGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-295s1c1
Sequence:CCGGCAGAAGAAGGATGGTCACCAACTCGAGTTGGTGACCATCCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-447s1c1
Sequence:CCGGGAGAACAACATTTCATGTGTACTCGAGTACACATGAAATGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-627s1c1
Sequence:CCGGCTTGAGGGTAACAATCAAATACTCGAGTATTTGATTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-693s1c1
Sequence:CCGGCCATGTGTAATATCACAAGAACTCGAGTTCTTGTGATATTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-685s1c1
Sequence:CCGGGCTTAGATCCATGTGTAATATCTCGAGATATTACACATGGATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-381s1c1
Sequence:CCGGCAAACACATCTGGAAGGTGATCTCGAGATCACCTTCCAGATGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-799s1c1
Sequence:CCGGGTAAATCTGGATATCATCCAACTCGAGTTGGATGATATCCAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005666
CFHR2 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-825s21c1
Sequence:CCGGTCTCATTCATTTCGAGCAATGCTCGAGCATTGCTCGAAATGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-849s21c1
Sequence:CCGGCAGAATGGGAAACTGGTATATCTCGAGATATACCAGTTTCCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-774s21c1
Sequence:CCGGACAGGTGACATAGTTGAATTTCTCGAGAAATTCAACTATGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-295s1c1
Sequence:CCGGCAGAAGAAGGATGGTCACCAACTCGAGTTGGTGACCATCCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-447s1c1
Sequence:CCGGGAGAACAACATTTCATGTGTACTCGAGTACACATGAAATGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-627s1c1
Sequence:CCGGCTTGAGGGTAACAATCAAATACTCGAGTATTTGATTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-693s1c1
Sequence:CCGGCCATGTGTAATATCACAAGAACTCGAGTTCTTGTGATATTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-685s1c1
Sequence:CCGGGCTTAGATCCATGTGTAATATCTCGAGATATTACACATGGATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-381s1c1
Sequence:CCGGCAAACACATCTGGAAGGTGATCTCGAGATCACCTTCCAGATGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-799s1c1
Sequence:CCGGGTAAATCTGGATATCATCCAACTCGAGTTGGATGATATCCAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005666
CFHR2 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-825s21c1
Sequence:CCGGTCTCATTCATTTCGAGCAATGCTCGAGCATTGCTCGAAATGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-849s21c1
Sequence:CCGGCAGAATGGGAAACTGGTATATCTCGAGATATACCAGTTTCCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005666.2-774s21c1
Sequence:CCGGACAGGTGACATAGTTGAATTTCTCGAGAAATTCAACTATGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-295s1c1
Sequence:CCGGCAGAAGAAGGATGGTCACCAACTCGAGTTGGTGACCATCCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-447s1c1
Sequence:CCGGGAGAACAACATTTCATGTGTACTCGAGTACACATGAAATGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-627s1c1
Sequence:CCGGCTTGAGGGTAACAATCAAATACTCGAGTATTTGATTGTTACCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-693s1c1
Sequence:CCGGCCATGTGTAATATCACAAGAACTCGAGTTCTTGTGATATTACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-685s1c1
Sequence:CCGGGCTTAGATCCATGTGTAATATCTCGAGATATTACACATGGATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005666.1-381s1c1
Sequence:CCGGCAAACACATCTGGAAGGTGATCTCGAGATCACCTTCCAGATGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005666.1-799s1c1
Sequence:CCGGGTAAATCTGGATATCATCCAACTCGAGTTGGATGATATCCAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025575
CFHR2 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-736s21c1
Sequence:CCGGTATCAGTGCCAGAAGTATTATCTCGAGATAATACTTCTGGCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-932s21c1
Sequence:CCGGGTAAACGTGGATATCAGAAAGCTCGAGCTTTCTGATATCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-352s1c1
Sequence:CCGGGGAAATAAGTACAGCTATAAGCTCGAGCTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-719s1c1
Sequence:CCGGCATTATCATCAGTTGACTATCCTCGAGGATAGTCAACTGATGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-970s21c1
Sequence:CCGGTTTCGTACAAAGTGCATTAATCTCGAGATTAATGCACTTTGTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025575.1-1335s21c1
Sequence:CCGGGGTTCTGATTTACAGTAAATACTCGAGTATTTACTGTAAATCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-351s21c1
Sequence:CCGGAGGAAATAAGTACAGCTATAACTCGAGTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-629s1c1
Sequence:CCGGGCATCCGTATCAACTCAACAACTCGAGTTGTTGAGTTGATACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-67s1c1
Sequence:CCGGGCATGGCTTTCTACTGCTAAACTCGAGTTTAGCAGTAGAAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025575.1-1234s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025575
CFHR2 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-736s21c1
Sequence:CCGGTATCAGTGCCAGAAGTATTATCTCGAGATAATACTTCTGGCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-932s21c1
Sequence:CCGGGTAAACGTGGATATCAGAAAGCTCGAGCTTTCTGATATCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-352s1c1
Sequence:CCGGGGAAATAAGTACAGCTATAAGCTCGAGCTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-719s1c1
Sequence:CCGGCATTATCATCAGTTGACTATCCTCGAGGATAGTCAACTGATGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-970s21c1
Sequence:CCGGTTTCGTACAAAGTGCATTAATCTCGAGATTAATGCACTTTGTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025575.1-1335s21c1
Sequence:CCGGGGTTCTGATTTACAGTAAATACTCGAGTATTTACTGTAAATCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-351s21c1
Sequence:CCGGAGGAAATAAGTACAGCTATAACTCGAGTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-629s1c1
Sequence:CCGGGCATCCGTATCAACTCAACAACTCGAGTTGTTGAGTTGATACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-67s1c1
Sequence:CCGGGCATGGCTTTCTACTGCTAAACTCGAGTTTAGCAGTAGAAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025575.1-1234s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025575
CFHR2 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-736s21c1
Sequence:CCGGTATCAGTGCCAGAAGTATTATCTCGAGATAATACTTCTGGCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-932s21c1
Sequence:CCGGGTAAACGTGGATATCAGAAAGCTCGAGCTTTCTGATATCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-352s1c1
Sequence:CCGGGGAAATAAGTACAGCTATAAGCTCGAGCTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-719s1c1
Sequence:CCGGCATTATCATCAGTTGACTATCCTCGAGGATAGTCAACTGATGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-970s21c1
Sequence:CCGGTTTCGTACAAAGTGCATTAATCTCGAGATTAATGCACTTTGTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025575.1-1335s21c1
Sequence:CCGGGGTTCTGATTTACAGTAAATACTCGAGTATTTACTGTAAATCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025575.1-351s21c1
Sequence:CCGGAGGAAATAAGTACAGCTATAACTCGAGTTATAGCTGTACTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-629s1c1
Sequence:CCGGGCATCCGTATCAACTCAACAACTCGAGTTGTTGAGTTGATACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025575.1-67s1c1
Sequence:CCGGGCATGGCTTTCTACTGCTAAACTCGAGTTTAGCAGTAGAAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025575.1-1234s1c1
Sequence:CCGGCCAAGGACAAACTATGTCAAACTCGAGTTTGACATAGTTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks