EMAIL THIS PAGE TO A FRIEND

CFHR3

complement factor H-related 3

34 Gene Product Result for
Synonyms: CFHL3 DOWN16 FHR-3 FHR3 HLF4
UniProtKB ID: Q02985, B4DPR0, Q9UJ16
Gene ID:
Human(10878) Summary: The protein encoded by this gene is a secreted protein, which belongs to the complement factor H-related protein family. It binds to heparin, and may be involved in complement regulation. Mutations in this gene are associated with decreased risk of age-related macular degeneration, and with an increased risk of atypical hemolytic-uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(624286) complement factor H-related 3
cow(519127) complement factor H-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021023 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110981 MISSION® esiRNA esiRNA human CFHR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021023 Rosetta Predictions human pricing
XM_888824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354499 predicted 1035
2 SASI_Hs02_00354500 predicted 1007
3 SASI_Hs02_00354501 predicted 125
4 SASI_Hs01_00094189 predicted 1255
5 SASI_Hs01_00094190 predicted 1261
6 SASI_Hs01_00094191 predicted 951
7 SASI_Hs01_00094192 predicted 927
8 SASI_Hs01_00094193 predicted 1179
9 SASI_Hs01_00094194 predicted 1280
10 SASI_Hs01_00094195 predicted 839
11 SASI_Hs01_00094196 predicted 1030
12 SASI_Hs01_00094197 predicted 1115
13 SASI_Hs01_00094198 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284446 predicted 423
2 SASI_Mm01_00284447 predicted 382
3 SASI_Mm01_00284448 predicted 615
4 SASI_Mm01_00284449 predicted 733
5 SASI_Mm01_00284450 predicted 618
6 SASI_Mm01_00284451 predicted 247
7 SASI_Mm01_00284452 predicted 281
8 SASI_Mm01_00284453 predicted 557
9 SASI_Mm01_00284454 predicted 291
10 SASI_Mm01_00284455 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021023
CFHR3 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-677s1c1
Sequence:CCGGCAATGGTGATACCACCTCCTTCTCGAGAAGGAGGTGGTATCACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-138s1c1
Sequence:CCGGCGTAGACCATACTTTCCAGTACTCGAGTACTGGAAAGTATGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-225s1c1
Sequence:CCGGGATTACATTCATTGCACACAACTCGAGTTGTGTGCAATGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-621s1c1
Sequence:CCGGGCACAACCAATTTGCATTAATCTCGAGATTAATGCAAATTGGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-497s1c1
Sequence:CCGGCATTTCTGAATCTTCCTCTATCTCGAGATAGAGGAAGATTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-178s1c1
Sequence:CCGGCCTATTACTGTGATGAACATTCTCGAGAATGTTCATCACAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-666s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-336s1c1
Sequence:CCGGGTACAGGGTAACTCTACAGAACTCGAGTTCTGTAGAGTTACCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-208s1c1
Sequence:CCGGCGTCAGGAAGTTACTGGGATTCTCGAGAATCCCAGTAACTTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021023
CFHR3 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-677s1c1
Sequence:CCGGCAATGGTGATACCACCTCCTTCTCGAGAAGGAGGTGGTATCACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-138s1c1
Sequence:CCGGCGTAGACCATACTTTCCAGTACTCGAGTACTGGAAAGTATGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-225s1c1
Sequence:CCGGGATTACATTCATTGCACACAACTCGAGTTGTGTGCAATGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-621s1c1
Sequence:CCGGGCACAACCAATTTGCATTAATCTCGAGATTAATGCAAATTGGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-497s1c1
Sequence:CCGGCATTTCTGAATCTTCCTCTATCTCGAGATAGAGGAAGATTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-178s1c1
Sequence:CCGGCCTATTACTGTGATGAACATTCTCGAGAATGTTCATCACAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-666s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-336s1c1
Sequence:CCGGGTACAGGGTAACTCTACAGAACTCGAGTTCTGTAGAGTTACCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-208s1c1
Sequence:CCGGCGTCAGGAAGTTACTGGGATTCTCGAGAATCCCAGTAACTTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021023
CFHR3 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-677s1c1
Sequence:CCGGCAATGGTGATACCACCTCCTTCTCGAGAAGGAGGTGGTATCACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-138s1c1
Sequence:CCGGCGTAGACCATACTTTCCAGTACTCGAGTACTGGAAAGTATGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-225s1c1
Sequence:CCGGGATTACATTCATTGCACACAACTCGAGTTGTGTGCAATGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-621s1c1
Sequence:CCGGGCACAACCAATTTGCATTAATCTCGAGATTAATGCAAATTGGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-497s1c1
Sequence:CCGGCATTTCTGAATCTTCCTCTATCTCGAGATAGAGGAAGATTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021023.1-178s1c1
Sequence:CCGGCCTATTACTGTGATGAACATTCTCGAGAATGTTCATCACAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-666s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-336s1c1
Sequence:CCGGGTACAGGGTAACTCTACAGAACTCGAGTTCTGTAGAGTTACCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021023.1-208s1c1
Sequence:CCGGCGTCAGGAAGTTACTGGGATTCTCGAGAATCCCAGTAACTTCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks