EMAIL THIS PAGE TO A FRIEND

CFHR4

complement factor H-related 4

24 Gene Product Result for
Synonyms: CFHL4 FHR-4 FHR4
Species: Human CFHR4(10877)
UniProtKB ID: Q92496, A8K9N7, B1ALQ9, C9J7J7, Q9UJY6
Gene ID:
Human(10877) Summary: This gene is a member of the complement factor H (CFH) gene family, and encodes one of the 5 CFH-related (CFHR) proteins. These 5 genes are closely linked to the CFH gene on chromosome 1q31-q32. The CFHRs are secreted plasma proteins synthesized primarily by the hepatocytes, and composed of highly-related short consensus repeats (SCRs). This protein enhances the cofactor activity of CFH, and is involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism. Alternatively spliced transcript variants encoding different isoforms (varying in the number of SCRs) have been described for this gene. [provided by RefSeq, Jan 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302626 ANTI-FHR4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006684 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128381 MISSION® esiRNA esiRNA human CFHR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006684 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342089 predicted 656
2 SASI_Hs01_00104852 predicted 643
3 SASI_Hs02_00342090 predicted 659
4 SASI_Hs02_00342091 predicted 658
5 SASI_Hs02_00342092 predicted 993
6 SASI_Hs02_00342093 predicted 556
7 SASI_Hs02_00342094 predicted 557
8 SASI_Hs02_00342095 predicted 583
9 SASI_Hs02_00342096 predicted 106
10 SASI_Hs02_00342097 predicted 214
11 SASI_Hs01_00104848 predicted 979
12 SASI_Hs01_00104849 predicted 992
13 SASI_Hs01_00104850 predicted 728
14 SASI_Hs01_00104851 predicted 890
15 SASI_Hs01_00104853 predicted 997
16 SASI_Hs01_00104854 predicted 877
17 SASI_Hs01_00104855 predicted 785
18 SASI_Hs01_00104856 predicted 1072
19 SASI_Hs01_00104857 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006684
CFHR4 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-562s1c1
Sequence:CCGGCAAGAGTAATGGCATGCGGTTCTCGAGAACCGCATGCCATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-604s1c1
Sequence:CCGGCTACGAATGCTACGATGGATACTCGAGTATCCATCGTAGCATTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-800s1c1
Sequence:CCGGCAATGCCAGTCCTACTATGAACTCGAGTTCATAGTAGGACTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-728s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-810s1c1
Sequence:CCGGCCTACTATGAACTTCAGGGTTCTCGAGAACCCTGAAGTTCATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006684.1-1140s1c1
Sequence:CCGGGCTTCGAAAGATAGCTTCTGACTCGAGTCAGAAGCTATCTTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-729s1c1
Sequence:CCGGCACCTATTAGCAATGGTGATACTCGAGTATCACCATTGCTAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-196s1c1
Sequence:CCGGGAGTTTGCGTAGACTATACTTCTCGAGAAGTATAGTCTACGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006684.1-1109s1c1
Sequence:CCGGCAACTTCACTTCTCACTCTTACTCGAGTAAGAGTGAGAAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-140s1c1
Sequence:CCGGCAAGAAGTGAAACCTTGTGATCTCGAGATCACAAGGTTTCACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-227s1c1
Sequence:CCGGGCAGGACAATCTTATTCCTATCTCGAGATAGGAATAAGATTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-612s1c1
Sequence:CCGGGCTACGATGGATATGAAATCACTCGAGTGATTTCATATCCATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006684
CFHR4 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-562s1c1
Sequence:CCGGCAAGAGTAATGGCATGCGGTTCTCGAGAACCGCATGCCATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-604s1c1
Sequence:CCGGCTACGAATGCTACGATGGATACTCGAGTATCCATCGTAGCATTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-800s1c1
Sequence:CCGGCAATGCCAGTCCTACTATGAACTCGAGTTCATAGTAGGACTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-728s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-810s1c1
Sequence:CCGGCCTACTATGAACTTCAGGGTTCTCGAGAACCCTGAAGTTCATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006684.1-1140s1c1
Sequence:CCGGGCTTCGAAAGATAGCTTCTGACTCGAGTCAGAAGCTATCTTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-729s1c1
Sequence:CCGGCACCTATTAGCAATGGTGATACTCGAGTATCACCATTGCTAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-196s1c1
Sequence:CCGGGAGTTTGCGTAGACTATACTTCTCGAGAAGTATAGTCTACGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006684.1-1109s1c1
Sequence:CCGGCAACTTCACTTCTCACTCTTACTCGAGTAAGAGTGAGAAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-140s1c1
Sequence:CCGGCAAGAAGTGAAACCTTGTGATCTCGAGATCACAAGGTTTCACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-227s1c1
Sequence:CCGGGCAGGACAATCTTATTCCTATCTCGAGATAGGAATAAGATTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-612s1c1
Sequence:CCGGGCTACGATGGATATGAAATCACTCGAGTGATTTCATATCCATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006684
CFHR4 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-562s1c1
Sequence:CCGGCAAGAGTAATGGCATGCGGTTCTCGAGAACCGCATGCCATTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-604s1c1
Sequence:CCGGCTACGAATGCTACGATGGATACTCGAGTATCCATCGTAGCATTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-800s1c1
Sequence:CCGGCAATGCCAGTCCTACTATGAACTCGAGTTCATAGTAGGACTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-728s1c1
Sequence:CCGGCCACCTATTAGCAATGGTGATCTCGAGATCACCATTGCTAATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-810s1c1
Sequence:CCGGCCTACTATGAACTTCAGGGTTCTCGAGAACCCTGAAGTTCATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006684.1-1140s1c1
Sequence:CCGGGCTTCGAAAGATAGCTTCTGACTCGAGTCAGAAGCTATCTTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-729s1c1
Sequence:CCGGCACCTATTAGCAATGGTGATACTCGAGTATCACCATTGCTAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-196s1c1
Sequence:CCGGGAGTTTGCGTAGACTATACTTCTCGAGAAGTATAGTCTACGCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006684.1-1109s1c1
Sequence:CCGGCAACTTCACTTCTCACTCTTACTCGAGTAAGAGTGAGAAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-140s1c1
Sequence:CCGGCAAGAAGTGAAACCTTGTGATCTCGAGATCACAAGGTTTCACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006684.1-227s1c1
Sequence:CCGGGCAGGACAATCTTATTCCTATCTCGAGATAGGAATAAGATTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006684.1-612s1c1
Sequence:CCGGGCTACGATGGATATGAAATCACTCGAGTGATTTCATATCCATCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks