EMAIL THIS PAGE TO A FRIEND

CFHR5

complement factor H-related 5

21 Gene Product Result for
Synonyms: CFHL5 CFHR5D FHR-5 FHR5
UniProtKB ID: Q9BXR6, Q2NKK2
Gene ID:
Human(81494) Summary: This gene is a member of a small complement factor H (CFH) gene cluster on chromosome 1. Each member of this gene family contains multiple short consensus repeats (SCRs) typical of regulators of complement activation. The protein encoded by this gene has nine SCRs with the first two repeats having heparin binding properties, a region within repeats 5-7 having heparin binding and C reactive protein binding properties, and the C-terminal repeats being similar to a complement component 3 b (C3b) binding domain. This protein co-localizes with C3, binds C3b in a dose-dependent manner, and is recruited to tissues damaged by C-reactive protein. Allelic variations in this gene have been associated, but not causally linked, with two different forms of kidney disease: membranoproliferative glomerulonephritis type II (MPGNII) and hemolytic uraemic syndrome (HUS). [provided by RefSeq, Jan 2010]
dog(490262) complement factor H-related 5
cow(100337035) complement factor H-related 5
Horse(100146849) complement factor H-related 5
sheep(101122966) complement factor H-related 5
Domestic Rabbit(100347766) complement factor H-related 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030787 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145181 MISSION® esiRNA esiRNA human CFHR5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030787 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084599 predicted 1745
2 SASI_Hs01_00084600 predicted 1097
3 SASI_Hs01_00084601 predicted 1157
4 SASI_Hs01_00084602 predicted 709
5 SASI_Hs01_00084603 predicted 534
6 SASI_Hs01_00084604 predicted 811
7 SASI_Hs01_00084605 predicted 931
8 SASI_Hs01_00084606 predicted 897
9 SASI_Hs01_00084608 predicted 957
10 SASI_Hs02_00358336 predicted 996
11 SASI_Hs01_00084607 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030787
CFHR5 MISSION shRNA Bacterial Glycerol Stock
complement factor H-related 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-1760s1c1
Sequence:CCGGCAATCTGTCAGGAAGGGAAATCTCGAGATTTCCCTTCCTGACAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-512s1c1
Sequence:CCGGGCAGCTTCACTAAAGGAGAATCTCGAGATTCTCCTTTAGTGAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-585s1c1
Sequence:CCGGCTACAAAGTTGGAGACGTGTTCTCGAGAACACGTCTCCAACTTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-1710s1c1
Sequence:CCGGCCAGTGTAAATTCCCACATAACTCGAGTTATGTGGGAATTTACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2397s1c1
Sequence:CCGGGCAGTTAAGTTTCCACGTAAACTCGAGTTTACGTGGAAACTTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2347s1c1
Sequence:CCGGCGTGACTTAATCACCTTCTAACTCGAGTTAGAAGGTGATTAAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-695s1c1
Sequence:CCGGGCAAAGGACAAGTACGATCATCTCGAGATGATCGTACTTGTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-692s1c1
Sequence:CCGGCATGCAAAGGACAAGTACGATCTCGAGATCGTACTTGTCCTTTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1094s21c1
Sequence:CCGGTGTTGCAACACACCAACTTAACTCGAGTTAAGTTGGTGTGTTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030787.3-2028s21c1
Sequence:CCGGAGGGTGTCTTAGTCCATATTACTCGAGTAATATGGACTAAGACACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1453s21c1
Sequence:CCGGGTGTTGAGTCTACTGCATATTCTCGAGAATATGCAGTAGACTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030787
CFHR5 MISSION shRNA shRNA Plasmid DNA
complement factor H-related 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-1760s1c1
Sequence:CCGGCAATCTGTCAGGAAGGGAAATCTCGAGATTTCCCTTCCTGACAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-512s1c1
Sequence:CCGGGCAGCTTCACTAAAGGAGAATCTCGAGATTCTCCTTTAGTGAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-585s1c1
Sequence:CCGGCTACAAAGTTGGAGACGTGTTCTCGAGAACACGTCTCCAACTTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-1710s1c1
Sequence:CCGGCCAGTGTAAATTCCCACATAACTCGAGTTATGTGGGAATTTACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2397s1c1
Sequence:CCGGGCAGTTAAGTTTCCACGTAAACTCGAGTTTACGTGGAAACTTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2347s1c1
Sequence:CCGGCGTGACTTAATCACCTTCTAACTCGAGTTAGAAGGTGATTAAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-695s1c1
Sequence:CCGGGCAAAGGACAAGTACGATCATCTCGAGATGATCGTACTTGTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-692s1c1
Sequence:CCGGCATGCAAAGGACAAGTACGATCTCGAGATCGTACTTGTCCTTTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1094s21c1
Sequence:CCGGTGTTGCAACACACCAACTTAACTCGAGTTAAGTTGGTGTGTTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030787.3-2028s21c1
Sequence:CCGGAGGGTGTCTTAGTCCATATTACTCGAGTAATATGGACTAAGACACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1453s21c1
Sequence:CCGGGTGTTGAGTCTACTGCATATTCTCGAGAATATGCAGTAGACTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030787
CFHR5 MISSION shRNA Lentiviral Transduction Particles
complement factor H-related 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-1760s1c1
Sequence:CCGGCAATCTGTCAGGAAGGGAAATCTCGAGATTTCCCTTCCTGACAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-512s1c1
Sequence:CCGGGCAGCTTCACTAAAGGAGAATCTCGAGATTCTCCTTTAGTGAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-585s1c1
Sequence:CCGGCTACAAAGTTGGAGACGTGTTCTCGAGAACACGTCTCCAACTTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-1710s1c1
Sequence:CCGGCCAGTGTAAATTCCCACATAACTCGAGTTATGTGGGAATTTACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2397s1c1
Sequence:CCGGGCAGTTAAGTTTCCACGTAAACTCGAGTTTACGTGGAAACTTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030787.1-2347s1c1
Sequence:CCGGCGTGACTTAATCACCTTCTAACTCGAGTTAGAAGGTGATTAAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030787.1-695s1c1
Sequence:CCGGGCAAAGGACAAGTACGATCATCTCGAGATGATCGTACTTGTCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030787.1-692s1c1
Sequence:CCGGCATGCAAAGGACAAGTACGATCTCGAGATCGTACTTGTCCTTTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1094s21c1
Sequence:CCGGTGTTGCAACACACCAACTTAACTCGAGTTAAGTTGGTGTGTTGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030787.3-2028s21c1
Sequence:CCGGAGGGTGTCTTAGTCCATATTACTCGAGTAATATGGACTAAGACACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030787.3-1453s21c1
Sequence:CCGGGTGTTGAGTCTACTGCATATTCTCGAGAATATGCAGTAGACTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)