EMAIL THIS PAGE TO A FRIEND

CFI

complement factor I

Synonyms: AHUS3 C3BINA C3b-INA FI IF KAF
UniProtKB ID: P05156, O60442
Gene ID:
Human(3426) Summary: This gene encodes a serine proteinase that is essential for regulating the complement cascade. The encoded preproprotein is cleaved to produce both heavy and light chains, which are linked by disulfide bonds to form a heterodimeric glycoprotein. This heterodimer can cleave and inactivate the complement components C4b and C3b, and it prevents the assembly of the C3 and C5 convertase enzymes. Defects in this gene cause complement factor I deficiency, an autosomal recessive disease associated with a susceptibility to pyogenic infections. Mutations in this gene have been associated with a predisposition to atypical hemolytic uraemic syndrome, a disease characterized by acute renal failure, microangiopathic hemolytic anemia and thrombocytopenia. Primary glomerulonephritis with immmune deposits is another condition associated with mutation of this gene. [provided by RefSeq, Jul 2008]
Mouse(12630) complement component factor i
Rat(79126) complement factor I
sheep(101119307) complement factor I
Domestic Rabbit(100338923) complement factor I
naked mole-rat(101705881) complement factor I
domestic guinea pig(100713918) complement factor I
Zebrafish(557557) complement factor I
dog(478515) complement factor I
cow(513197) complement factor I
Horse(100072852) complement factor I
domestic cat(101086649) complement factor I
chicken(428773) complement factor I
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104231 MISSION® esiRNA esiRNA human CFI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000204 Rosetta Predictions human pricing
NM_024157 Rosetta Predictions rat pricing
NM_007686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139044 predicted 1803
2 SASI_Hs01_00139045 predicted 1143
3 SASI_Hs02_00302081 predicted 334
4 SASI_Hs01_00139048 predicted 1572
5 SASI_Hs01_00139049 predicted 1462
6 SASI_Hs01_00139050 predicted 998
7 SASI_Hs02_00302082 predicted 1858
8 SASI_Hs01_00139051 predicted 695
9 SASI_Hs01_00139052 predicted 688
10 SASI_Hs01_00139053 predicted 1202
11 SASI_Hs01_00139046 predicted 1539
12 SASI_Hs01_00139047 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119835 predicted 1227
2 SASI_Rn01_00119836 predicted 1127
3 SASI_Rn01_00119837 predicted 1432
4 SASI_Rn01_00119838 predicted 663
5 SASI_Rn02_00263892 predicted 972
6 SASI_Rn01_00119839 predicted 335
7 SASI_Rn01_00119840 predicted 1450
8 SASI_Rn02_00263893 predicted 1338
9 SASI_Rn01_00119841 predicted 491
10 SASI_Rn01_00119842 predicted 287
11 SASI_Rn01_00119843 predicted 1725
12 SASI_Rn01_00119844 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065629 predicted 904
2 SASI_Mm01_00065630 predicted 1838
3 SASI_Mm01_00065632 predicted 722
4 SASI_Mm01_00065633 predicted 1410
5 SASI_Mm01_00065634 predicted 1193
6 SASI_Mm01_00065635 predicted 1502
7 SASI_Mm01_00065636 predicted 1302
8 SASI_Mm01_00065637 predicted 592
9 SASI_Mm02_00312217 predicted 1030
10 SASI_Mm02_00312218 predicted 1330
11 SASI_Mm01_00065628 predicted 822
12 SASI_Mm01_00065631 predicted 1736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000204
CFI MISSION shRNA Bacterial Glycerol Stock
complement factor I
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1144s21c1
Sequence:CCGGTGCAGAAAGAAGACGGATAAACTCGAGTTTATCCGTCTTCTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-323s21c1
Sequence:CCGGACTCACCTCTCCTGCGATAAACTCGAGTTTATCGCAGGAGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1414s21c1
Sequence:CCGGCGACCTTAAACGTATAGTAATCTCGAGATTACTATACGTTTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1884s21c1
Sequence:CCGGACACCAAAGTGGCCAATTATTCTCGAGAATAATTGGCCACTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1730s21c1
Sequence:CCGGATGGAATGTGCAGGTACATATCTCGAGATATGTACCTGCACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1262s21c1
Sequence:CCGGCCATGGCAGGTGGCAATTAAGCTCGAGCTTAATTGCCACCTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-1219s1c1
Sequence:CCGGCCGACCTTAAACGTATAGTAACTCGAGTTACTATACGTTTAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-337s1c1
Sequence:CCGGCCGAAGGAAAGTTTAGTGTTTCTCGAGAAACACTAAACTTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000204
CFI MISSION shRNA shRNA Plasmid DNA
complement factor I
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1144s21c1
Sequence:CCGGTGCAGAAAGAAGACGGATAAACTCGAGTTTATCCGTCTTCTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-323s21c1
Sequence:CCGGACTCACCTCTCCTGCGATAAACTCGAGTTTATCGCAGGAGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1414s21c1
Sequence:CCGGCGACCTTAAACGTATAGTAATCTCGAGATTACTATACGTTTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1884s21c1
Sequence:CCGGACACCAAAGTGGCCAATTATTCTCGAGAATAATTGGCCACTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1730s21c1
Sequence:CCGGATGGAATGTGCAGGTACATATCTCGAGATATGTACCTGCACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1262s21c1
Sequence:CCGGCCATGGCAGGTGGCAATTAAGCTCGAGCTTAATTGCCACCTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-1219s1c1
Sequence:CCGGCCGACCTTAAACGTATAGTAACTCGAGTTACTATACGTTTAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-337s1c1
Sequence:CCGGCCGAAGGAAAGTTTAGTGTTTCTCGAGAAACACTAAACTTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000204
CFI MISSION shRNA Lentiviral Transduction Particles
complement factor I
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1144s21c1
Sequence:CCGGTGCAGAAAGAAGACGGATAAACTCGAGTTTATCCGTCTTCTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-323s21c1
Sequence:CCGGACTCACCTCTCCTGCGATAAACTCGAGTTTATCGCAGGAGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1414s21c1
Sequence:CCGGCGACCTTAAACGTATAGTAATCTCGAGATTACTATACGTTTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1884s21c1
Sequence:CCGGACACCAAAGTGGCCAATTATTCTCGAGAATAATTGGCCACTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1730s21c1
Sequence:CCGGATGGAATGTGCAGGTACATATCTCGAGATATGTACCTGCACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000204.3-1262s21c1
Sequence:CCGGCCATGGCAGGTGGCAATTAAGCTCGAGCTTAATTGCCACCTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-1219s1c1
Sequence:CCGGCCGACCTTAAACGTATAGTAACTCGAGTTACTATACGTTTAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000204.1-337s1c1
Sequence:CCGGCCGAAGGAAAGTTTAGTGTTTCTCGAGAAACACTAAACTTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007686
VALIDATED
CFI MISSION shRNA Bacterial Glycerol Stock
complement factor I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1503s21c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007686.2-1892s21c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1315s21c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-903s21c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-906s1c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-427s1c1
Sequence:CCGGCCTTAATTTATGGGAGAACAACTCGAGTTGTTCTCCCATAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1506s1c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1895s1c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1318s1c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007686
VALIDATED
CFI MISSION shRNA shRNA Plasmid DNA
complement factor I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1503s21c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007686.2-1892s21c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1315s21c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-903s21c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-906s1c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-427s1c1
Sequence:CCGGCCTTAATTTATGGGAGAACAACTCGAGTTGTTCTCCCATAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1506s1c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1895s1c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1318s1c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007686
VALIDATED
CFI MISSION shRNA Lentiviral Transduction Particles
complement factor I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1503s21c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007686.2-1892s21c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-1315s21c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007686.2-903s21c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-906s1c1
Sequence:CCGGCCAGACCAATACAAGTGTAATCTCGAGATTACACTTGTATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-427s1c1
Sequence:CCGGCCTTAATTTATGGGAGAACAACTCGAGTTGTTCTCCCATAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1506s1c1
Sequence:CCGGCCATATCTGTTCCAACCGAATCTCGAGATTCGGTTGGAACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1895s1c1
Sequence:CCGGCCTCCTTCTTTCTACATTTATCTCGAGATAAATGTAGAAAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007686.1-1318s1c1
Sequence:CCGGCGGCTTTATTAGACTGGCTAACTCGAGTTAGCCAGTCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks