EMAIL THIS PAGE TO A FRIEND

CFL1

cofilin 1 (non-muscle)

71 Gene Product Result for
Synonyms: CFL
UniProtKB ID: P23528, B3KUQ1, Q53Y87, Q9UCA2
Gene ID:
Human(1072) Summary: The protein encoded by this gene can polymerize and depolymerize F-actin and G-actin in a pH-dependent manner. Increased phosphorylation of this protein by LIM kinase aids in Rho-induced reorganization of the actin cytoskeleton. Cofilin is a widely distributed intracellular actin-modulating protein that binds and depolymerizes filamentous F-actin and inhibits the polymerization of monomeric G-actin in a pH-dependent manner. It is involved in the translocation of actin-cofilin complex from cytoplasm to nucleus.[supplied by OMIM, Apr 2004]
Mouse(12631) cofilin 1, non-muscle
Rat(29271) cofilin 1, non-muscle
Zebrafish(406738) cofilin 1 (non-muscle)
cow(534553) cofilin 1 (non-muscle)
dog(476022) cofilin 1 (non-muscle)
domestic cat(101100251) cofilin 1 (non-muscle)
naked mole-rat(101713836) cofilin 1 (non-muscle)
domestic guinea pig(100732287) cofilin 1 (non-muscle)
sheep(494432) cofilin 1 (non-muscle)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300577 Anti-CCFL1/CFL2 (Ab-88) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300431 Anti-CFL1 (Ab-3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
HPA053761 Anti-CFL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
C8736 Anti-Cofilin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, canine, rat
immunofluorescence, microarray, western blot pricing
SAB4300115 Anti-phospho-CFL1 (pSer3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300262 Anti-phospho-CFL1 (pTyr139) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry pricing
SAB4300263 Anti-phospho-CFL1/CFL2 (pTyr88) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
C8992 Anti-phospho-Cofilin (pSer3) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat (predicted), pig (predicted)
western blot pricing
SAB4504370 Anti-phospho-Cofilin (pSer3) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB1305599 ANTI-PHOSPHO-COFILIN(SER3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
WH0001072M4 Monoclonal Anti-CFL1 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB2702206 Monoclonal Anti-Cofilin 1 antibody produced in mouse clone GT567, affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005507 Rosetta Predictions human pricing
NM_017147 Rosetta Predictions rat pricing
NM_007687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078353 predicted 512
2 SASI_Hs01_00078356 predicted 471
3 SASI_Hs01_00078357 predicted 401
4 SASI_Hs01_00078359 predicted 612
5 SASI_Hs01_00078361 predicted 505
6 SASI_Hs01_00078352 predicted 476
7 SASI_Hs02_00339715 predicted 320
8 SASI_Hs01_00078355 predicted 617
9 SASI_Hs02_00339716 predicted 518
10 SASI_Hs02_00339717 predicted 289
11 SASI_Hs01_00078354 predicted 479
12 SASI_Hs01_00078358 predicted 458
13 SASI_Hs01_00078360 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067540 predicted 531
2 SASI_Rn01_00067546 predicted 895
3 SASI_Rn02_00261415 predicted 174
4 SASI_Rn02_00261416 predicted 137
5 SASI_Rn02_00261417 predicted 166
6 SASI_Rn01_00067539 predicted 492
7 SASI_Rn01_00067541 predicted 630
8 SASI_Rn01_00067542 predicted 478
9 SASI_Rn01_00067543 predicted 632
10 SASI_Rn01_00067544 predicted 550
11 SASI_Rn01_00067545 predicted 766
12 SASI_Rn01_00067547 predicted 939
13 SASI_Rn01_00067548 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085184 predicted 684
2 SASI_Mm01_00085185 predicted 386
3 SASI_Mm01_00085187 predicted 209
4 SASI_Mm02_00312219 predicted 237
5 SASI_Mm02_00312220 predicted 239
6 SASI_Mm02_00312221 predicted 377
7 SASI_Mm02_00312222 predicted 258
8 SASI_Mm02_00312223 predicted 531
9 SASI_Mm02_00312224 predicted 541
10 SASI_Mm02_00312225 predicted 366
11 SASI_Mm01_00085186 predicted 763
12 SASI_Mm01_00085188 predicted 910
13 SASI_Mm01_00085189 predicted 1016
14 SASI_Mm01_00085190 predicted 551
15 SASI_Mm01_00085191 predicted 898
16 SASI_Mm01_00085192 predicted 484
17 SASI_Mm01_00085193 predicted 122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005507
VALIDATED
CFL1 MISSION shRNA Bacterial Glycerol Stock
cofilin 1 (non-muscle)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-298s1c1
Sequence:CCGGGCCCTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-433s1c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-315s1c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-277s1c1
Sequence:CCGGCCAGATAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-444s1c1
Sequence:CCGGCAAGCATGAATTGCAAGCAAACTCGAGTTTGCTTGCAATTCATGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-281s21c1
Sequence:GTACCGGACGACATGAAGGTGCGTAAGTCTCGAGACTTACGCACCTTCATGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005507.2-1073s21c1
Sequence:CCGGTGCCAACTTCTAACCGCAATACTCGAGTATTGCGGTTAGAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-616s21c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-498s21c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-447s21c1
Sequence:CCGGTGTCAAGATGCTGCCAGATAACTCGAGTTATCTGGCAGCATCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-634s21c1
Sequence:GTACCGGGAATTGCAAGCAAACTGCTACCTCGAGGTAGCAGTTTGCTTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-269s21c1
Sequence:GTACCGGTCAAGGTGTTCAACGACATGACTCGAGTCATGTCGTTGAACACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-349s21c1
Sequence:GTACCGGTGCCTGAGTGAGGACAAGAAGCTCGAGCTTCTTGTCCTCACTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-314s21c1
Sequence:GTACCGGAGGAGGTGAAGAAGCGCAAGACTCGAGTCTTGCGCTTCTTCACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-518s21c1
Sequence:GTACCGGAGAAGGAGGATCTGGTGTTTACTCGAGTAAACACCAGATCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-436s21c1
Sequence:GTACCGGTACGCCACCTTTGTCAAGATGCTCGAGCATCTTGACAAAGGTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005507
VALIDATED
CFL1 MISSION shRNA shRNA Plasmid DNA
cofilin 1 (non-muscle)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-298s1c1
Sequence:CCGGGCCCTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-433s1c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-315s1c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-277s1c1
Sequence:CCGGCCAGATAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-444s1c1
Sequence:CCGGCAAGCATGAATTGCAAGCAAACTCGAGTTTGCTTGCAATTCATGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-281s21c1
Sequence:GTACCGGACGACATGAAGGTGCGTAAGTCTCGAGACTTACGCACCTTCATGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005507.2-1073s21c1
Sequence:CCGGTGCCAACTTCTAACCGCAATACTCGAGTATTGCGGTTAGAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-616s21c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-498s21c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-447s21c1
Sequence:CCGGTGTCAAGATGCTGCCAGATAACTCGAGTTATCTGGCAGCATCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-634s21c1
Sequence:GTACCGGGAATTGCAAGCAAACTGCTACCTCGAGGTAGCAGTTTGCTTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-269s21c1
Sequence:GTACCGGTCAAGGTGTTCAACGACATGACTCGAGTCATGTCGTTGAACACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-349s21c1
Sequence:GTACCGGTGCCTGAGTGAGGACAAGAAGCTCGAGCTTCTTGTCCTCACTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-314s21c1
Sequence:GTACCGGAGGAGGTGAAGAAGCGCAAGACTCGAGTCTTGCGCTTCTTCACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-518s21c1
Sequence:GTACCGGAGAAGGAGGATCTGGTGTTTACTCGAGTAAACACCAGATCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-436s21c1
Sequence:GTACCGGTACGCCACCTTTGTCAAGATGCTCGAGCATCTTGACAAAGGTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005507
VALIDATED
CFL1 MISSION shRNA Lentiviral Transduction Particles
cofilin 1 (non-muscle)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-298s1c1
Sequence:CCGGGCCCTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-433s1c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-315s1c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-277s1c1
Sequence:CCGGCCAGATAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005507.1-444s1c1
Sequence:CCGGCAAGCATGAATTGCAAGCAAACTCGAGTTTGCTTGCAATTCATGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-281s21c1
Sequence:GTACCGGACGACATGAAGGTGCGTAAGTCTCGAGACTTACGCACCTTCATGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005507.2-1073s21c1
Sequence:CCGGTGCCAACTTCTAACCGCAATACTCGAGTATTGCGGTTAGAAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-616s21c1
Sequence:CCGGCTGACAGGGATCAAGCATGAACTCGAGTTCATGCTTGATCCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-498s21c1
Sequence:CCGGCTATGAGACCAAGGAGAGCAACTCGAGTTGCTCTCCTTGGTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-447s21c1
Sequence:CCGGTGTCAAGATGCTGCCAGATAACTCGAGTTATCTGGCAGCATCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-634s21c1
Sequence:GTACCGGGAATTGCAAGCAAACTGCTACCTCGAGGTAGCAGTTTGCTTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-269s21c1
Sequence:GTACCGGTCAAGGTGTTCAACGACATGACTCGAGTCATGTCGTTGAACACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-349s21c1
Sequence:GTACCGGTGCCTGAGTGAGGACAAGAAGCTCGAGCTTCTTGTCCTCACTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-314s21c1
Sequence:GTACCGGAGGAGGTGAAGAAGCGCAAGACTCGAGTCTTGCGCTTCTTCACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-518s21c1
Sequence:GTACCGGAGAAGGAGGATCTGGTGTTTACTCGAGTAAACACCAGATCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005507.2-436s21c1
Sequence:GTACCGGTACGCCACCTTTGTCAAGATGCTCGAGCATCTTGACAAAGGTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007687
VALIDATED
CFL1 MISSION shRNA Bacterial Glycerol Stock
cofilin 1 (non-muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-323s1c1
Sequence:CCGGGCACTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-137s1c1
Sequence:CCGGCGCAAGTCTTCAACACCAGAACTCGAGTTCTGGTGTTGAAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-121s1c1
Sequence:CCGGCAATGACATGAAGGTTCGCAACTCGAGTTGCGAACCTTCATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-302s1c1
Sequence:CCGGCCAGACAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-547s1c1
Sequence:CCGGCGTCATTTCCCTGGAGGGCAACTCGAGTTGCCCTCCAGGGAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007687
VALIDATED
CFL1 MISSION shRNA shRNA Plasmid DNA
cofilin 1 (non-muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-323s1c1
Sequence:CCGGGCACTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-137s1c1
Sequence:CCGGCGCAAGTCTTCAACACCAGAACTCGAGTTCTGGTGTTGAAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-121s1c1
Sequence:CCGGCAATGACATGAAGGTTCGCAACTCGAGTTGCGAACCTTCATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-302s1c1
Sequence:CCGGCCAGACAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-547s1c1
Sequence:CCGGCGTCATTTCCCTGGAGGGCAACTCGAGTTGCCCTCCAGGGAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007687
VALIDATED
CFL1 MISSION shRNA Lentiviral Transduction Particles
cofilin 1 (non-muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-323s1c1
Sequence:CCGGGCACTCTATGATGCAACCTATCTCGAGATAGGTTGCATCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-137s1c1
Sequence:CCGGCGCAAGTCTTCAACACCAGAACTCGAGTTCTGGTGTTGAAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-121s1c1
Sequence:CCGGCAATGACATGAAGGTTCGCAACTCGAGTTGCGAACCTTCATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-302s1c1
Sequence:CCGGCCAGACAAGGACTGCCGCTATCTCGAGATAGCGGCAGTCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007687.2-547s1c1
Sequence:CCGGCGTCATTTCCCTGGAGGGCAACTCGAGTTGCCCTCCAGGGAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks