EMAIL THIS PAGE TO A FRIEND

CFL2

cofilin 2 (muscle)

245 Gene Product Result for
Synonyms: NEM7
UniProtKB ID: Q9Y281, G3V5P4
Gene ID:
Human(1073) Summary: This gene encodes an intracellular protein that is involved in the regulation of actin-filament dynamics. This protein is a major component of intranuclear and cytoplasmic actin rods. It can bind G- and F-actin in a 1:1 ratio of cofilin to actin, and it reversibly controls actin polymerization and depolymerization in a pH-dependent manner. Mutations in this gene cause nemaline myopathy type 7, a form of congenital myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Mouse(12632) cofilin 2, muscle
Rat(366624) cofilin 2, muscle
Zebrafish(403001) cofilin 2 (muscle)
domestic cat(101083089) cofilin 2 (muscle)
cow(539332) cofilin 2 (muscle)
dog(490649) cofilin 2 (muscle)
chicken(423320) cofilin 2 (muscle)
sheep(101118388) cofilin 2 (muscle)
domestic guinea pig(100727405) cofilin 2 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021914 Rosetta Predictions human pricing
NM_138638 Rosetta Predictions human pricing
NM_001108982 Rosetta Predictions rat pricing
NM_007688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355194 predicted 803
2 SASI_Hs01_00216384 predicted 413
3 SASI_Hs01_00216385 predicted 467
4 SASI_Hs01_00216386 predicted 336
5 SASI_Hs01_00216387 predicted 728
6 SASI_Hs01_00216388 predicted 401
7 SASI_Hs02_00355195 predicted 524
8 SASI_Hs01_00216390 predicted 723
9 SASI_Hs01_00216391 predicted 293
10 SASI_Hs02_00355196 predicted 281
11 SASI_Hs01_00216383 predicted 464
12 SASI_Hs01_00216389 predicted 775
13 SASI_Hs01_00216392 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363775 predicted 903
2 SASI_Hs01_00116241 predicted 511
3 SASI_Hs01_00116242 predicted 556
4 SASI_Hs01_00116243 predicted 431
5 SASI_Hs01_00116244 predicted 821
6 SASI_Hs01_00116245 predicted 492
7 SASI_Hs02_00363776 predicted 620
8 SASI_Hs01_00116247 predicted 818
9 SASI_Hs01_00116248 predicted 398
10 SASI_Hs02_00363777 predicted 378
11 SASI_Hs01_00116240 predicted 466
12 SASI_Hs01_00116246 predicted 783
13 SASI_Hs01_00116249 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244004 predicted 1679
2 SASI_Rn02_00244005 predicted 1854
3 SASI_Rn02_00244006 predicted 1713
4 SASI_Rn02_00244007 predicted 1706
5 SASI_Rn02_00244008 predicted 2004
6 SASI_Rn02_00244009 predicted 1912
7 SASI_Rn02_00244010 predicted 1952
8 SASI_Rn02_00244011 predicted 1852
9 SASI_Rn02_00244012 predicted 1756
10 SASI_Rn02_00244013 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124339 predicted 437
2 SASI_Mm01_00124340 predicted 478
3 SASI_Mm01_00124347 predicted 445
4 SASI_Mm01_00124348 predicted 477
5 SASI_Mm01_00124343 predicted 363
6 SASI_Mm01_00124344 predicted 201
7 SASI_Mm01_00124345 predicted 468
8 SASI_Mm01_00124341 predicted 216
9 SASI_Mm01_00124342 predicted 224
10 SASI_Mm01_00124346 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021914
VALIDATED
CFL2 MISSION shRNA Bacterial Glycerol Stock
cofilin 2 (muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021914.7-600s21c1
Sequence:CCGGGGGAGGCAATGTAGTAGTTTCCTCGAGGAAACTACTACATTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021914.7-695s21c1
Sequence:CCGGAGTCCATTGGAATAGTATTAGCTCGAGCTAATACTATTCCAATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-378s1c1
Sequence:CCGGCCTCTGAATGATTGCCGATATCTCGAGATATCGGCAATCATTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-588s1c1
Sequence:CCGGCGTTCGACACTTGGAGAGAAACTCGAGTTTCTCTCCAAGTGTCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-407s1c1
Sequence:CCGGCGATGCCACATACGAAACAAACTCGAGTTTGTTTCGTATGTGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-504s1c1
Sequence:CCGGGCTAGCTCTAAAGATGCCATTCTCGAGAATGGCATCTTTAGAGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021914.5-263s1c1
Sequence:CCGGCTTCTGTTTAAGCGATGACAACTCGAGTTGTCATCGCTTAAACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021914
VALIDATED
CFL2 MISSION shRNA shRNA Plasmid DNA
cofilin 2 (muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021914.7-600s21c1
Sequence:CCGGGGGAGGCAATGTAGTAGTTTCCTCGAGGAAACTACTACATTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021914.7-695s21c1
Sequence:CCGGAGTCCATTGGAATAGTATTAGCTCGAGCTAATACTATTCCAATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-378s1c1
Sequence:CCGGCCTCTGAATGATTGCCGATATCTCGAGATATCGGCAATCATTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-588s1c1
Sequence:CCGGCGTTCGACACTTGGAGAGAAACTCGAGTTTCTCTCCAAGTGTCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-407s1c1
Sequence:CCGGCGATGCCACATACGAAACAAACTCGAGTTTGTTTCGTATGTGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-504s1c1
Sequence:CCGGGCTAGCTCTAAAGATGCCATTCTCGAGAATGGCATCTTTAGAGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021914.5-263s1c1
Sequence:CCGGCTTCTGTTTAAGCGATGACAACTCGAGTTGTCATCGCTTAAACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021914
VALIDATED
CFL2 MISSION shRNA Lentiviral Transduction Particles
cofilin 2 (muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021914.7-600s21c1
Sequence:CCGGGGGAGGCAATGTAGTAGTTTCCTCGAGGAAACTACTACATTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021914.7-695s21c1
Sequence:CCGGAGTCCATTGGAATAGTATTAGCTCGAGCTAATACTATTCCAATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-378s1c1
Sequence:CCGGCCTCTGAATGATTGCCGATATCTCGAGATATCGGCAATCATTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-588s1c1
Sequence:CCGGCGTTCGACACTTGGAGAGAAACTCGAGTTTCTCTCCAAGTGTCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-407s1c1
Sequence:CCGGCGATGCCACATACGAAACAAACTCGAGTTTGTTTCGTATGTGGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021914.5-504s1c1
Sequence:CCGGGCTAGCTCTAAAGATGCCATTCTCGAGAATGGCATCTTTAGAGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021914.5-263s1c1
Sequence:CCGGCTTCTGTTTAAGCGATGACAACTCGAGTTGTCATCGCTTAAACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007688
VALIDATED
CFL2 MISSION shRNA Bacterial Glycerol Stock
cofilin 2 (muscle)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-540s21c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-242s21c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-411s21c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-610s21c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-201s21c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-610s1c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-201s1c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-540s1c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-242s1c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-411s1c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007688
VALIDATED
CFL2 MISSION shRNA shRNA Plasmid DNA
cofilin 2 (muscle)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-540s21c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-242s21c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-411s21c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-610s21c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-201s21c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-610s1c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-201s1c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-540s1c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-242s1c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-411s1c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007688
VALIDATED
CFL2 MISSION shRNA Lentiviral Transduction Particles
cofilin 2 (muscle)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-540s21c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-242s21c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-411s21c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-610s21c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007688.2-201s21c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-610s1c1
Sequence:CCGGCCCTTGAAGGAAAGCCACTATCTCGAGATAGTGGCTTTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-201s1c1
Sequence:CCGGTCTACACAGGAGGAGATCAAACTCGAGTTTGATCTCCTCCTGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-540s1c1
Sequence:CCGGGTAAATGGCTTGGACGATATTCTCGAGAATATCGTCCAAGCCATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007688.1-242s1c1
Sequence:CCGGCTTCTGTTTGAGCGATGACAACTCGAGTTGTCATCGCTCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007688.1-411s1c1
Sequence:CCGGTCTAAGAAAGAAGACCTAGTACTCGAGTACTAGGTCTTCTTTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks