EMAIL THIS PAGE TO A FRIEND

CFLAR

CASP8 and FADD-like apoptosis regulator

123 Gene Product Result for
Synonyms: CASH CASP8AP1 CLARP Casper FLAME FLAME-1 FLAME1 FLIP I-FLICE MRIT c-FLIP c-FLIPL c-FLIPR c-FLIPS
Gene ID:
Human(8837) Summary: The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
Mouse(12633) CASP8 and FADD-like apoptosis regulator
Rat(117279) CASP8 and FADD-like apoptosis regulator
chicken(424080) CASP8 and FADD-like apoptosis regulator
dog(488471) CASP8 and FADD-like apoptosis regulator
domestic cat(100142680) CASP8 and FADD-like apoptosis regulator
Horse(100068181) CASP8 and FADD-like apoptosis regulator
cow(497199) CASP8 and FADD-like apoptosis regulator
naked mole-rat(101713835) CASP8 and FADD-like apoptosis regulator
domestic guinea pig(100717997) CASP8 and FADD-like apoptosis regulator
Goat(100860786) CASP8 and FADD-like apoptosis regulator
Domestic Rabbit(100346964) CASP8 and FADD-like apoptosis regulator
sheep(101106914) CASP8 and FADD-like apoptosis regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406737 Anti-CFLAR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108102 Anti-CFLAR antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV00022 Anti-CFLAR antibody produced in rabbit IgG fraction of antiserum canine, human, bovine, rat, pig, mouse
western blot pricing
SAB2100411 Anti-CFLAR antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
HPA019044 Anti-CFLAR antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500429 Anti-FLIP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, flow cytometry, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
F9800 Anti-FLIP, N-Terminal antibody produced in rabbit 1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
F6550 Anti-FLIPα, C-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F9925 Anti-FLIPγ/δ, C-Terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human
microarray, western blot pricing
F9675 Anti-FLIPL C-Terminal antibody produced in rabbit ~0.5 mg/mL, IgG fraction of antiserum, buffered aqueous solution mouse
ELISA, immunocytochemistry, western blot pricing
WH0008837M1 Monoclonal Anti-CFLAR antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404634 Monoclonal Anti-CFLAR antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003879 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093481 MISSION® esiRNA esiRNA human CFLAR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127183 Rosetta Predictions human pricing
NM_001127184 Rosetta Predictions human pricing
NM_003879 Rosetta Predictions human pricing
NM_001033864 Rosetta Predictions rat pricing
NM_057138 Rosetta Predictions rat pricing
NM_009805 Rosetta Predictions mouse pricing
NM_207653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328617 predicted 442
2 SASI_Hs02_00328618 predicted 627
3 SASI_Hs02_00328619 predicted 559
4 SASI_Hs02_00328620 predicted 566
5 SASI_Hs02_00328621 predicted 667
6 SASI_Hs02_00328622 predicted 689
7 SASI_Hs02_00328623 predicted 690
8 SASI_Hs02_00328624 predicted 561
9 SASI_Hs02_00328625 predicted 627
10 SASI_Hs02_00328626 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328627 predicted 594
2 SASI_Hs02_00328628 predicted 781
3 SASI_Hs02_00328629 predicted 705
4 SASI_Hs02_00328630 predicted 718
5 SASI_Hs02_00328631 predicted 814
6 SASI_Hs02_00328632 predicted 843
7 SASI_Hs02_00328633 predicted 836
8 SASI_Hs02_00328634 predicted 710
9 SASI_Hs02_00328635 predicted 787
10 SASI_Hs02_00328636 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336473 predicted 523
2 SASI_Hs02_00336474 predicted 707
3 SASI_Hs01_00086562 predicted 635
4 SASI_Hs02_00336475 predicted 649
5 SASI_Hs01_00086563 predicted 738
6 SASI_Hs01_00086565 predicted 773
7 SASI_Hs02_00336476 predicted 766
8 SASI_Hs02_00336477 predicted 639
9 SASI_Hs02_00336478 predicted 705
10 SASI_Hs02_00336479 predicted 551
11 SASI_Hs01_00086560 predicted 1331
12 SASI_Hs01_00086561 predicted 991
13 SASI_Hs01_00086564 predicted 1206
14 SASI_Hs01_00086566 predicted 1314
15 SASI_Hs01_00086567 predicted 1333
16 SASI_Hs01_00086568 predicted 1019
17 SASI_Hs01_00086569 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036326 predicted 592
2 SASI_Rn01_00036327 predicted 421
3 SASI_Rn01_00036328 predicted 535
4 SASI_Rn01_00036329 predicted 298
5 SASI_Rn01_00036330 predicted 391
6 SASI_Rn01_00036331 predicted 585
7 SASI_Rn01_00036332 predicted 590
8 SASI_Rn01_00036333 predicted 547
9 SASI_Rn01_00036334 predicted 279
10 SASI_Rn01_00036335 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056334 predicted 591
2 SASI_Rn01_00056335 predicted 417
3 SASI_Rn01_00056336 predicted 537
4 SASI_Rn01_00056337 predicted 307
5 SASI_Rn01_00056338 predicted 390
6 SASI_Rn01_00056339 predicted 592
7 SASI_Rn01_00056340 predicted 590
8 SASI_Rn01_00056341 predicted 543
9 SASI_Rn01_00056342 predicted 281
10 SASI_Rn01_00056343 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167440 predicted 635
2 SASI_Mm01_00167441 predicted 776
3 SASI_Mm01_00167442 predicted 511
4 SASI_Mm01_00167444 predicted 836
5 SASI_Mm01_00167445 predicted 543
6 SASI_Mm01_00167446 predicted 571
7 SASI_Mm01_00167447 predicted 882
8 SASI_Mm02_00317084 predicted 834
9 SASI_Mm02_00317085 predicted 575
10 SASI_Mm01_00167448 predicted 789
11 SASI_Mm01_00167443 predicted 810
12 SASI_Mm01_00167449 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073218 predicted 638
2 SASI_Mm01_00073219 predicted 770
3 SASI_Mm01_00073220 predicted 517
4 SASI_Mm01_00073222 predicted 835
5 SASI_Mm01_00073223 predicted 538
6 SASI_Mm01_00073224 predicted 579
7 SASI_Mm01_00073225 predicted 888
8 SASI_Mm02_00352171 predicted 837
9 SASI_Mm02_00352172 predicted 577
10 SASI_Mm01_00073226 predicted 787
11 SASI_Mm01_00073221 predicted 785
12 SASI_Mm01_00073227 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009805
CFLAR MISSION shRNA Bacterial Glycerol Stock
CASP8 and FADD-like apoptosis regulator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-623s1c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-137s1c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-348s1c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-287s1c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-779s21c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-984s21c1
Sequence:CCGGGCCTGAAGAACATCCACAGAACTCGAGTTCTGTGGATGTTCTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-718s21c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-1045s21c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-568s21c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009805
CFLAR MISSION shRNA shRNA Plasmid DNA
CASP8 and FADD-like apoptosis regulator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-623s1c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-137s1c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-348s1c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-287s1c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-779s21c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-984s21c1
Sequence:CCGGGCCTGAAGAACATCCACAGAACTCGAGTTCTGTGGATGTTCTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-718s21c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-1045s21c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-568s21c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009805
CFLAR MISSION shRNA Lentiviral Transduction Particles
CASP8 and FADD-like apoptosis regulator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-623s1c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-137s1c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-348s1c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009805.1-287s1c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-779s21c1
Sequence:CCGGCCTCACCTGGTTTCTGATTATCTCGAGATAATCAGAAACCAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-984s21c1
Sequence:CCGGGCCTGAAGAACATCCACAGAACTCGAGTTCTGTGGATGTTCTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-718s21c1
Sequence:CCGGCCTTCTCAAGAGGATCTTGAACTCGAGTTCAAGATCCTCTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-1045s21c1
Sequence:CCGGCCAAGGAGCAAGATCAAATATCTCGAGATATTTGATCTTGCTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009805.4-568s21c1
Sequence:CCGGCGAGAAGGAGATGATGCTCTTCTCGAGAAGAGCATCATCTCCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003879
VALIDATED
CFLAR MISSION shRNA Bacterial Glycerol Stock
CASP8 and FADD-like apoptosis regulator
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003879.3-1954s1c1
Sequence:CCGGCACCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003879.3-740s1c1
Sequence:CCGGCCTCACCTTGTTTCGGACTATCTCGAGATAGTCCGAAACAAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1087s1c1
Sequence:CCGGGCTCCATAATGGGAGAAGTAACTCGAGTTACTTCTCCCATTATGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1480s1c1
Sequence:CCGGGCATCACATCAGGAGGATGTTCTCGAGAACATCCTCCTGATGTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1888s1c1
Sequence:CCGGCACTCTGAGAAAGAAACTTATCTCGAGATAAGTTTCTTTCTCAGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-808s21c1
Sequence:CCGGACATGGGCCGAGGCAAGATAACTCGAGTTATCTTGCCTCGGCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-888s21c1
Sequence:CCGGCCAGATCAACTGGATTTATTACTCGAGTAATAAATCCAGTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-712s21c1
Sequence:CCGGCTCACCTTGTTTCGGACTATACTCGAGTATAGTCCGAAACAAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-627s21c1
Sequence:CCGGCTCTACAGAGTGAGGCGATTTCTCGAGAAATCGCCTCACTCTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-751s21c1
Sequence:CCGGTTGGTGAGGATTTGGATAAATCTCGAGATTTATCCAAATCCTCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-1300s21c1
Sequence:CCGGATCTCAGTATGCATGGTATATCTCGAGATATACCATGCATACTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003879.4-2007s21c1
Sequence:CCGGGTAAACGCTGTCCCTAGTAAACTCGAGTTTACTAGGGACAGCGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-541s21c1
Sequence:CCGGTAGATGTGGTTCCACCTAATGCTCGAGCATTAGGTGGAACCACATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003879
VALIDATED
CFLAR MISSION shRNA shRNA Plasmid DNA
CASP8 and FADD-like apoptosis regulator
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003879.3-1954s1c1
Sequence:CCGGCACCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003879.3-740s1c1
Sequence:CCGGCCTCACCTTGTTTCGGACTATCTCGAGATAGTCCGAAACAAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1087s1c1
Sequence:CCGGGCTCCATAATGGGAGAAGTAACTCGAGTTACTTCTCCCATTATGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1480s1c1
Sequence:CCGGGCATCACATCAGGAGGATGTTCTCGAGAACATCCTCCTGATGTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1888s1c1
Sequence:CCGGCACTCTGAGAAAGAAACTTATCTCGAGATAAGTTTCTTTCTCAGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-808s21c1
Sequence:CCGGACATGGGCCGAGGCAAGATAACTCGAGTTATCTTGCCTCGGCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-888s21c1
Sequence:CCGGCCAGATCAACTGGATTTATTACTCGAGTAATAAATCCAGTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-712s21c1
Sequence:CCGGCTCACCTTGTTTCGGACTATACTCGAGTATAGTCCGAAACAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-627s21c1
Sequence:CCGGCTCTACAGAGTGAGGCGATTTCTCGAGAAATCGCCTCACTCTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-751s21c1
Sequence:CCGGTTGGTGAGGATTTGGATAAATCTCGAGATTTATCCAAATCCTCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-1300s21c1
Sequence:CCGGATCTCAGTATGCATGGTATATCTCGAGATATACCATGCATACTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003879.4-2007s21c1
Sequence:CCGGGTAAACGCTGTCCCTAGTAAACTCGAGTTTACTAGGGACAGCGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-541s21c1
Sequence:CCGGTAGATGTGGTTCCACCTAATGCTCGAGCATTAGGTGGAACCACATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003879
VALIDATED
CFLAR MISSION shRNA Lentiviral Transduction Particles
CASP8 and FADD-like apoptosis regulator
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003879.3-1954s1c1
Sequence:CCGGCACCTGTAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTACAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003879.3-740s1c1
Sequence:CCGGCCTCACCTTGTTTCGGACTATCTCGAGATAGTCCGAAACAAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1087s1c1
Sequence:CCGGGCTCCATAATGGGAGAAGTAACTCGAGTTACTTCTCCCATTATGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1480s1c1
Sequence:CCGGGCATCACATCAGGAGGATGTTCTCGAGAACATCCTCCTGATGTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003879.3-1888s1c1
Sequence:CCGGCACTCTGAGAAAGAAACTTATCTCGAGATAAGTTTCTTTCTCAGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-808s21c1
Sequence:CCGGACATGGGCCGAGGCAAGATAACTCGAGTTATCTTGCCTCGGCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-888s21c1
Sequence:CCGGCCAGATCAACTGGATTTATTACTCGAGTAATAAATCCAGTTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-712s21c1
Sequence:CCGGCTCACCTTGTTTCGGACTATACTCGAGTATAGTCCGAAACAAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-627s21c1
Sequence:CCGGCTCTACAGAGTGAGGCGATTTCTCGAGAAATCGCCTCACTCTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-751s21c1
Sequence:CCGGTTGGTGAGGATTTGGATAAATCTCGAGATTTATCCAAATCCTCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-1300s21c1
Sequence:CCGGATCTCAGTATGCATGGTATATCTCGAGATATACCATGCATACTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003879.4-2007s21c1
Sequence:CCGGGTAAACGCTGTCCCTAGTAAACTCGAGTTTACTAGGGACAGCGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003879.4-541s21c1
Sequence:CCGGTAGATGTGGTTCCACCTAATGCTCGAGCATTAGGTGGAACCACATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)