EMAIL THIS PAGE TO A FRIEND

CFP

complement factor properdin

120 Gene Product Result for
Synonyms: BFD PFC PFD PROPERDIN
UniProtKB ID: P27918, O15134, O15135, O15136, O75826
Gene ID:
Human(5199) Summary: This gene encodes a plasma glycoprotein that positively regulates the alternative complement pathway of the innate immune system. This protein binds to many microbial surfaces and apoptotic cells and stabilizes the C3- and C5-convertase enzyme complexes in a feedback loop that ultimately leads to formation of the membrane attack complex and lysis of the target cell. Mutations in this gene result in two forms of properdin deficiency, which results in high susceptibility to meningococcal infections. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Feb 2009]
Mouse(18636) complement factor properdin
Rat(299314) complement factor properdin
Zebrafish(556399) complement factor properdin
dog(491859) complement factor properdin
domestic cat(101090086) complement factor properdin
cow(539605) complement factor properdin
Horse(100051317) complement factor properdin
naked mole-rat(101724230) complement factor properdin
domestic guinea pig(100728194) complement factor properdin
sheep(101114678) complement factor properdin
Domestic Rabbit(100340696) complement factor properdin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021661 MISSION® esiRNA esiRNA human CFP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002621 Rosetta Predictions human pricing
NM_001106757 Rosetta Predictions rat pricing
NM_008823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010921 predicted 1373
2 SASI_Hs01_00010923 predicted 771
3 SASI_Hs01_00010924 predicted 891
4 SASI_Hs01_00010925 predicted 352
5 SASI_Hs02_00334135 predicted 1232
6 SASI_Hs01_00010926 predicted 417
7 SASI_Hs01_00010927 predicted 1298
8 SASI_Hs01_00010928 predicted 1227
9 SASI_Hs01_00010929 predicted 1336
10 SASI_Hs01_00010930 predicted 900
11 SASI_Hs01_00010922 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222098 predicted 1083
2 SASI_Rn02_00222099 predicted 1248
3 SASI_Rn02_00222100 predicted 889
4 SASI_Rn02_00222101 predicted 992
5 SASI_Rn02_00222102 predicted 652
6 SASI_Rn02_00222103 predicted 905
7 SASI_Rn02_00222104 predicted 905
8 SASI_Rn02_00222105 predicted 1125
9 SASI_Rn02_00222106 predicted 1073
10 SASI_Rn02_00222107 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102885 predicted 267
2 SASI_Mm01_00102886 predicted 723
3 SASI_Mm01_00102887 predicted 527
4 SASI_Mm01_00102888 predicted 705
5 SASI_Mm02_00314759 predicted 229
6 SASI_Mm01_00102889 predicted 392
7 SASI_Mm01_00102890 predicted 1146
8 SASI_Mm02_00314760 predicted 231
9 SASI_Mm01_00102892 predicted 524
10 SASI_Mm01_00102893 predicted 500
11 SASI_Mm01_00102891 predicted 229
12 SASI_Mm01_00102894 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002621
CFP MISSION shRNA Bacterial Glycerol Stock
complement factor properdin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1078s21c1
Sequence:CCGGTGGAACAACGGACGTGCAATCCTCGAGGATTGCACGTCCGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1609s21c1
Sequence:CCGGTACACGTGCCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGGCACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-424s1c1
Sequence:CCGGCCTTTGCCTACCAGAAACGTACTCGAGTACGTTTCTGGTAGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-347s1c1
Sequence:CCGGGTATGAAGAATCCTCCGGCAACTCGAGTTGCCGGAGGATTCTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-883s1c1
Sequence:CCGGACGAACCTAAGGAGACACGAACTCGAGTTCGTGTCTCCTTAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1300s1c1
Sequence:CCGGGCAAGTTTGACGGACATCGATCTCGAGATCGATGTCCGTCAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1226s1c1
Sequence:CCGGCCGACGGAACATGAAGTCCATCTCGAGATGGACTTCATGTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002621
CFP MISSION shRNA shRNA Plasmid DNA
complement factor properdin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1078s21c1
Sequence:CCGGTGGAACAACGGACGTGCAATCCTCGAGGATTGCACGTCCGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1609s21c1
Sequence:CCGGTACACGTGCCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGGCACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-424s1c1
Sequence:CCGGCCTTTGCCTACCAGAAACGTACTCGAGTACGTTTCTGGTAGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-347s1c1
Sequence:CCGGGTATGAAGAATCCTCCGGCAACTCGAGTTGCCGGAGGATTCTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-883s1c1
Sequence:CCGGACGAACCTAAGGAGACACGAACTCGAGTTCGTGTCTCCTTAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1300s1c1
Sequence:CCGGGCAAGTTTGACGGACATCGATCTCGAGATCGATGTCCGTCAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1226s1c1
Sequence:CCGGCCGACGGAACATGAAGTCCATCTCGAGATGGACTTCATGTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002621
CFP MISSION shRNA Lentiviral Transduction Particles
complement factor properdin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1078s21c1
Sequence:CCGGTGGAACAACGGACGTGCAATCCTCGAGGATTGCACGTCCGTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002621.2-1609s21c1
Sequence:CCGGTACACGTGCCTGCTTGCAAAGCTCGAGCTTTGCAAGCAGGCACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-424s1c1
Sequence:CCGGCCTTTGCCTACCAGAAACGTACTCGAGTACGTTTCTGGTAGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-347s1c1
Sequence:CCGGGTATGAAGAATCCTCCGGCAACTCGAGTTGCCGGAGGATTCTTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-883s1c1
Sequence:CCGGACGAACCTAAGGAGACACGAACTCGAGTTCGTGTCTCCTTAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1300s1c1
Sequence:CCGGGCAAGTTTGACGGACATCGATCTCGAGATCGATGTCCGTCAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002621.1-1226s1c1
Sequence:CCGGCCGACGGAACATGAAGTCCATCTCGAGATGGACTTCATGTTCCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008823
CFP MISSION shRNA Bacterial Glycerol Stock
complement factor properdin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1131s1c1
Sequence:CCGGCCAGGATATTCGACACTGCTACTCGAGTAGCAGTGTCGAATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1313s1c1
Sequence:CCGGGTGAGAAGAATGTTACCTTCTCTCGAGAGAAGGTAACATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-488s1c1
Sequence:CCGGCTGTCACATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-186s1c1
Sequence:CCGGGAGAGACATCAGGGTAGAAGACTCGAGTCTTCTACCCTGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-941s1c1
Sequence:CCGGCCACTCGGAACCAAATGTGTACTCGAGTACACATTTGGTTCCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-517s1c1
Sequence:CCGGCGTCAACGAGTATGTGATAATCTCGAGATTATCACATACTCGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008823
CFP MISSION shRNA shRNA Plasmid DNA
complement factor properdin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1131s1c1
Sequence:CCGGCCAGGATATTCGACACTGCTACTCGAGTAGCAGTGTCGAATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1313s1c1
Sequence:CCGGGTGAGAAGAATGTTACCTTCTCTCGAGAGAAGGTAACATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-488s1c1
Sequence:CCGGCTGTCACATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-186s1c1
Sequence:CCGGGAGAGACATCAGGGTAGAAGACTCGAGTCTTCTACCCTGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-941s1c1
Sequence:CCGGCCACTCGGAACCAAATGTGTACTCGAGTACACATTTGGTTCCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-517s1c1
Sequence:CCGGCGTCAACGAGTATGTGATAATCTCGAGATTATCACATACTCGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008823
CFP MISSION shRNA Lentiviral Transduction Particles
complement factor properdin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1131s1c1
Sequence:CCGGCCAGGATATTCGACACTGCTACTCGAGTAGCAGTGTCGAATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008823.1-1313s1c1
Sequence:CCGGGTGAGAAGAATGTTACCTTCTCTCGAGAGAAGGTAACATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-488s1c1
Sequence:CCGGCTGTCACATGCTCCAAAGGAACTCGAGTTCCTTTGGAGCATGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-186s1c1
Sequence:CCGGGAGAGACATCAGGGTAGAAGACTCGAGTCTTCTACCCTGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-941s1c1
Sequence:CCGGCCACTCGGAACCAAATGTGTACTCGAGTACACATTTGGTTCCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008823.1-517s1c1
Sequence:CCGGCGTCAACGAGTATGTGATAATCTCGAGATTATCACATACTCGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks