EMAIL THIS PAGE TO A FRIEND

CFTR

cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)

96 Gene Product Result for
Synonyms: ABC35 ABCC7 CF CFTR/MRP MRP7 TNR-CFTR dJ760C5.1
UniProtKB ID: P13569, Q20BG8, Q20BH2, Q2I0A1, Q2I102
Gene ID:
Human(1080) Summary: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily that is involved in multi-drug resistance. The encoded protein functions as a chloride channel and controls the regulation of other transport pathways. Mutations in this gene are associated with the autosomal recessive disorders cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternatively spliced transcript variants have been described, many of which result from mutations in this gene. [provided by RefSeq, Jul 2008]
Mouse(12638) cystic fibrosis transmembrane conductance regulator
Rat(24255) cystic fibrosis transmembrane conductance regulator
Zebrafish(559080) cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)
chicken(100049619) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
dog(492302) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
domestic cat(492308) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
cow(281067) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Horse(100071259) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
naked mole-rat(101709472) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
domestic guinea pig(100135647) cystic fibrosis transmembrane conductance regulator homolog
domestic guinea pig(100719898) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
sheep(443347) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Domestic Rabbit(100009471) cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000492 Rosetta Predictions human pricing
NM_031506 Rosetta Predictions rat pricing
XM_001059206 Rosetta Predictions rat pricing
XM_001062374 Rosetta Predictions rat pricing
NM_021050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302648 predicted 2663
2 SASI_Hs01_00083058 predicted 2059
3 SASI_Hs02_00302649 predicted 1425
4 SASI_Hs01_00083059 predicted 2297
5 SASI_Hs01_00083060 predicted 449
6 SASI_Hs01_00083061 predicted 3560
7 SASI_Hs01_00083062 predicted 2780
8 SASI_Hs02_00302650 predicted 4219
9 SASI_Hs01_00083063 predicted 4200
10 SASI_Hs01_00083064 predicted 3136
11 SASI_Hs01_00083057 predicted 4307
12 SASI_Hs01_00083065 predicted 1209
13 SASI_Hs01_00083066 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038787 predicted 822
2 SASI_Rn01_00038788 predicted 3563
3 SASI_Rn01_00038789 predicted 3082
4 SASI_Rn02_00264629 predicted 3660
5 SASI_Rn02_00264630 predicted 1826
6 SASI_Rn02_00264631 predicted 668
7 SASI_Rn01_00038792 predicted 4206
8 SASI_Rn01_00038794 predicted 4069
9 SASI_Rn01_00038795 predicted 2552
10 SASI_Rn01_00038796 predicted 590
11 SASI_Rn01_00038790 predicted 510
12 SASI_Rn01_00038791 predicted 2659
13 SASI_Rn01_00038793 predicted 3716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292390 predicted 1001
2 SASI_Rn02_00292391 predicted 3753
3 SASI_Rn02_00292392 predicted 3845
4 SASI_Rn02_00292393 predicted 2016
5 SASI_Rn02_00292394 predicted 851
6 SASI_Rn02_00292395 predicted 4394
7 SASI_Rn02_00292396 predicted 294
8 SASI_Rn02_00292397 predicted 4248
9 SASI_Rn02_00292398 predicted 2732
10 SASI_Rn02_00292399 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303271 predicted 999
2 SASI_Rn02_00303272 predicted 3750
3 SASI_Rn02_00303273 predicted 3265
4 SASI_Rn02_00303274 predicted 3840
5 SASI_Rn02_00303275 predicted 2019
6 SASI_Rn02_00303276 predicted 849
7 SASI_Rn02_00303277 predicted 4399
8 SASI_Rn02_00303278 predicted 4247
9 SASI_Rn02_00303279 predicted 2728
10 SASI_Rn02_00303280 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028452 predicted 1616
2 SASI_Mm01_00028453 predicted 3563
3 SASI_Mm01_00028454 predicted 1167
4 SASI_Mm01_00028456 predicted 824
5 SASI_Mm01_00028457 predicted 3776
6 SASI_Mm01_00028458 predicted 4066
7 SASI_Mm01_00028459 predicted 588
8 SASI_Mm01_00028460 predicted 4209
9 SASI_Mm01_00028461 predicted 4344
10 SASI_Mm02_00325789 predicted 4374
11 SASI_Mm01_00028455 predicted 4099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000492
CFTR MISSION shRNA Bacterial Glycerol Stock
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000492.2-5332s1c1
Sequence:CCGGCCCTTGATGAAGAAGTTGATACTCGAGTATCAACTTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-225s1c1
Sequence:CCGGCCTGGAATTGTCAGACATATACTCGAGTATATGTCTGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4048s1c1
Sequence:CCGGCCCTATGAACAGTGGAGTGATCTCGAGATCACTCCACTGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4398s1c1
Sequence:CCGGGCAGTACGATTCCATCCAGAACTCGAGTTCTGGATGGAATCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-3517s1c1
Sequence:CCGGGTTGGTATTATCCTGACTTTACTCGAGTAAAGTCAGGATAATACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-3793s21c1
Sequence:CCGGGAAGGTGGAAATGCCATATTACTCGAGTAATATGGCATTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-2072s21c1
Sequence:CCGGGTGATTCTTTCGACCAATTTACTCGAGTAAATTGGTCGAAAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000492
CFTR MISSION shRNA shRNA Plasmid DNA
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000492.2-5332s1c1
Sequence:CCGGCCCTTGATGAAGAAGTTGATACTCGAGTATCAACTTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-225s1c1
Sequence:CCGGCCTGGAATTGTCAGACATATACTCGAGTATATGTCTGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4048s1c1
Sequence:CCGGCCCTATGAACAGTGGAGTGATCTCGAGATCACTCCACTGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4398s1c1
Sequence:CCGGGCAGTACGATTCCATCCAGAACTCGAGTTCTGGATGGAATCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-3517s1c1
Sequence:CCGGGTTGGTATTATCCTGACTTTACTCGAGTAAAGTCAGGATAATACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-3793s21c1
Sequence:CCGGGAAGGTGGAAATGCCATATTACTCGAGTAATATGGCATTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-2072s21c1
Sequence:CCGGGTGATTCTTTCGACCAATTTACTCGAGTAAATTGGTCGAAAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000492
CFTR MISSION shRNA Lentiviral Transduction Particles
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000492.2-5332s1c1
Sequence:CCGGCCCTTGATGAAGAAGTTGATACTCGAGTATCAACTTCTTCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-225s1c1
Sequence:CCGGCCTGGAATTGTCAGACATATACTCGAGTATATGTCTGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4048s1c1
Sequence:CCGGCCCTATGAACAGTGGAGTGATCTCGAGATCACTCCACTGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-4398s1c1
Sequence:CCGGGCAGTACGATTCCATCCAGAACTCGAGTTCTGGATGGAATCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000492.2-3517s1c1
Sequence:CCGGGTTGGTATTATCCTGACTTTACTCGAGTAAAGTCAGGATAATACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-3793s21c1
Sequence:CCGGGAAGGTGGAAATGCCATATTACTCGAGTAATATGGCATTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000492.3-2072s21c1
Sequence:CCGGGTGATTCTTTCGACCAATTTACTCGAGTAAATTGGTCGAAAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021050
CFTR MISSION shRNA Bacterial Glycerol Stock
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-4258s1c1
Sequence:CCGGCCCATAACATACCAAGTCATTCTCGAGAATGACTTGGTATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1208s1c1
Sequence:CCGGCCGTACAGATATGGTATGATTCTCGAGAATCATACCATATCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1207s1c1
Sequence:CCGGGCCGTACAGATATGGTATGATCTCGAGATCATACCATATCTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021050.1-5560s1c1
Sequence:CCGGGCCTGGATAATTTCCTTGATACTCGAGTATCAAGGAAATTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1834s1c1
Sequence:CCGGGCTGATTTGTACCTATTAGATCTCGAGATCTAATAGGTACAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021050
CFTR MISSION shRNA shRNA Plasmid DNA
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-4258s1c1
Sequence:CCGGCCCATAACATACCAAGTCATTCTCGAGAATGACTTGGTATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1208s1c1
Sequence:CCGGCCGTACAGATATGGTATGATTCTCGAGAATCATACCATATCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1207s1c1
Sequence:CCGGGCCGTACAGATATGGTATGATCTCGAGATCATACCATATCTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021050.1-5560s1c1
Sequence:CCGGGCCTGGATAATTTCCTTGATACTCGAGTATCAAGGAAATTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1834s1c1
Sequence:CCGGGCTGATTTGTACCTATTAGATCTCGAGATCTAATAGGTACAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021050
CFTR MISSION shRNA Lentiviral Transduction Particles
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-4258s1c1
Sequence:CCGGCCCATAACATACCAAGTCATTCTCGAGAATGACTTGGTATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1208s1c1
Sequence:CCGGCCGTACAGATATGGTATGATTCTCGAGAATCATACCATATCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1207s1c1
Sequence:CCGGGCCGTACAGATATGGTATGATCTCGAGATCATACCATATCTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021050.1-5560s1c1
Sequence:CCGGGCCTGGATAATTTCCTTGATACTCGAGTATCAAGGAAATTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021050.1-1834s1c1
Sequence:CCGGGCTGATTTGTACCTATTAGATCTCGAGATCTAATAGGTACAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks