EMAIL THIS PAGE TO A FRIEND

CGA

glycoprotein hormones, alpha polypeptide

73 Gene Product Result for
Synonyms: CG-ALPHA FSHA GPHA1 GPHa HCG LHA TSHA
UniProtKB ID: P01215
Gene ID:
Human(1081) Summary: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(12640) glycoprotein hormones, alpha subunit
Rat(116700) glycoprotein hormones, alpha polypeptide
Zebrafish(402987) glycoprotein hormones, alpha polypeptide
dog(403483) glycoprotein hormones, alpha polypeptide
cow(280749) glycoprotein hormones, alpha polypeptide
domestic cat(751819) glycoprotein hormones, alpha polypeptide
chicken(421829) glycoprotein hormones, alpha polypeptide
Goat(100860817) glycoprotein hormones, alpha polypeptide
Domestic Rabbit(100009481) glycoprotein hormones, alpha polypeptide
sheep(443538) glycoprotein hormones, alpha polypeptide
domestic guinea pig(100135499) glycoprotein hormones, alpha subunit
naked mole-rat(101704979) glycoprotein hormones, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411838 ANTI-CG-alpha antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411839 ANTI-CG-alpha antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411840 ANTI-CG-alpha antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411841 ANTI-CG-alpha antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411842 ANTI-CG-alpha antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411843 ANTI-CG-alpha antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411844 ANTI-CG-alpha antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1408559 Anti-CGA antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA029698 Anti-CGA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C8534 Anti-Chorionic Gonadotropin (α+β subunits) (HCG) antibody produced in rabbit whole antiserum human
immunohistochemistry, radioimmunoassay pricing
SAB1305712 ANTI-TSH-ALPHA(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056421 MISSION® esiRNA esiRNA human CGA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000735 Rosetta Predictions human pricing
NM_053918 Rosetta Predictions rat pricing
NM_009889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166638 predicted 425
2 SASI_Hs01_00166639 predicted 342
3 SASI_Hs02_00303163 predicted 415
4 SASI_Hs02_00303164 predicted 335
5 SASI_Hs01_00166640 predicted 418
6 SASI_Hs01_00166641 predicted 278
7 SASI_Hs01_00166642 predicted 344
8 SASI_Hs02_00303165 predicted 413
9 SASI_Hs01_00166646 predicted 409
10 SASI_Hs02_00303166 predicted 267
11 SASI_Hs01_00166637 predicted 471
12 SASI_Hs01_00166643 predicted 343
13 SASI_Hs01_00166644 predicted 346
14 SASI_Hs01_00166645 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045379 predicted 369
2 SASI_Rn01_00045380 predicted 305
3 SASI_Rn01_00045381 predicted 302
4 SASI_Rn02_00266861 predicted 299
5 SASI_Rn01_00045382 predicted 264
6 SASI_Rn02_00266862 predicted 262
7 SASI_Rn01_00045383 predicted 346
8 SASI_Rn01_00045384 predicted 285
9 SASI_Rn01_00045385 predicted 243
10 SASI_Rn01_00045387 predicted 333
11 SASI_Rn01_00045386 predicted 372
12 SASI_Rn01_00045388 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085941 predicted 193
2 SASI_Mm01_00085942 predicted 340
3 SASI_Mm01_00085943 predicted 350
4 SASI_Mm01_00085944 predicted 315
5 SASI_Mm01_00085946 predicted 199
6 SASI_Mm01_00085947 predicted 317
7 SASI_Mm01_00085948 predicted 267
8 SASI_Mm01_00085950 predicted 395
9 SASI_Mm02_00317387 predicted 422
10 SASI_Mm02_00317388 predicted 346
11 SASI_Mm01_00085945 predicted 319
12 SASI_Mm01_00085949 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000735
VALIDATED
CGA MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormones, alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-182s21c1
Sequence:CCGGTGTGCAGGATTGCCCAGAATGCTCGAGCATTCTGGGCAATCCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000735.2-518s21c1
Sequence:CCGGGTTTATGGCTTTGTGAGATAACTCGAGTTATCTCACAAAGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-304s21c1
Sequence:CCGGAGAAGACGATGTTGGTCCAAACTCGAGTTTGGACCAACATCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-276s1c1
Sequence:CCGGAGAGCATATCCCACTCCACTACTCGAGTAGTGGAGTGGGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-134s1c1
Sequence:CCGGTCTGGTCACATTGTCGGTGTTCTCGAGAACACCGACAATGTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000735.2-467s1c1
Sequence:CCGGGCTGTCTTGATGACTGCTGATCTCGAGATCAGCAGTCATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-349s1c1
Sequence:CCGGGCTGTGTAGCTAAATCATATACTCGAGTATATGATTTAGCTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000735.2-419s1c1
Sequence:CCGGCCACTGCAGTACTTGTTATTACTCGAGTAATAACAAGTACTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000735
VALIDATED
CGA MISSION shRNA shRNA Plasmid DNA
glycoprotein hormones, alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-182s21c1
Sequence:CCGGTGTGCAGGATTGCCCAGAATGCTCGAGCATTCTGGGCAATCCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000735.2-518s21c1
Sequence:CCGGGTTTATGGCTTTGTGAGATAACTCGAGTTATCTCACAAAGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-304s21c1
Sequence:CCGGAGAAGACGATGTTGGTCCAAACTCGAGTTTGGACCAACATCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-276s1c1
Sequence:CCGGAGAGCATATCCCACTCCACTACTCGAGTAGTGGAGTGGGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-134s1c1
Sequence:CCGGTCTGGTCACATTGTCGGTGTTCTCGAGAACACCGACAATGTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000735.2-467s1c1
Sequence:CCGGGCTGTCTTGATGACTGCTGATCTCGAGATCAGCAGTCATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-349s1c1
Sequence:CCGGGCTGTGTAGCTAAATCATATACTCGAGTATATGATTTAGCTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000735.2-419s1c1
Sequence:CCGGCCACTGCAGTACTTGTTATTACTCGAGTAATAACAAGTACTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000735
VALIDATED
CGA MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormones, alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-182s21c1
Sequence:CCGGTGTGCAGGATTGCCCAGAATGCTCGAGCATTCTGGGCAATCCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000735.2-518s21c1
Sequence:CCGGGTTTATGGCTTTGTGAGATAACTCGAGTTATCTCACAAAGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000735.2-304s21c1
Sequence:CCGGAGAAGACGATGTTGGTCCAAACTCGAGTTTGGACCAACATCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-276s1c1
Sequence:CCGGAGAGCATATCCCACTCCACTACTCGAGTAGTGGAGTGGGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-134s1c1
Sequence:CCGGTCTGGTCACATTGTCGGTGTTCTCGAGAACACCGACAATGTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000735.2-467s1c1
Sequence:CCGGGCTGTCTTGATGACTGCTGATCTCGAGATCAGCAGTCATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000735.2-349s1c1
Sequence:CCGGGCTGTGTAGCTAAATCATATACTCGAGTATATGATTTAGCTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000735.2-419s1c1
Sequence:CCGGCCACTGCAGTACTTGTTATTACTCGAGTAATAACAAGTACTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009889
CGA MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormones, alpha polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009889.1-501s1c1
Sequence:CCGGCGAGCCATTCAATGGCGCTGTCTCGAGACAGCGCCATTGAATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-139s1c1
Sequence:CCGGGCTGTCCATGTTCCTGCATATCTCGAGATATGCAGGAACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-203s1c1
Sequence:CCGGCCAGAATGTAAACTAAAGGAACTCGAGTTCCTTTAGTTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-427s1c1
Sequence:CCGGCCACTGTAGCACTTGCTACTACTCGAGTAGTAGCAAGTGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-371s1c1
Sequence:CCGGGCATTTACTAAGGCCACAGTACTCGAGTACTGTGGCCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009889
CGA MISSION shRNA shRNA Plasmid DNA
glycoprotein hormones, alpha polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009889.1-501s1c1
Sequence:CCGGCGAGCCATTCAATGGCGCTGTCTCGAGACAGCGCCATTGAATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-139s1c1
Sequence:CCGGGCTGTCCATGTTCCTGCATATCTCGAGATATGCAGGAACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-203s1c1
Sequence:CCGGCCAGAATGTAAACTAAAGGAACTCGAGTTCCTTTAGTTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-427s1c1
Sequence:CCGGCCACTGTAGCACTTGCTACTACTCGAGTAGTAGCAAGTGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-371s1c1
Sequence:CCGGGCATTTACTAAGGCCACAGTACTCGAGTACTGTGGCCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009889
CGA MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormones, alpha polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009889.1-501s1c1
Sequence:CCGGCGAGCCATTCAATGGCGCTGTCTCGAGACAGCGCCATTGAATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-139s1c1
Sequence:CCGGGCTGTCCATGTTCCTGCATATCTCGAGATATGCAGGAACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-203s1c1
Sequence:CCGGCCAGAATGTAAACTAAAGGAACTCGAGTTCCTTTAGTTTACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-427s1c1
Sequence:CCGGCCACTGTAGCACTTGCTACTACTCGAGTAGTAGCAAGTGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009889.1-371s1c1
Sequence:CCGGGCATTTACTAAGGCCACAGTACTCGAGTACTGTGGCCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks