EMAIL THIS PAGE TO A FRIEND

CGB1

chorionic gonadotropin, beta polypeptide 1

26 Gene Product Result for
Species: Human CGB1(114335)
UniProtKB ID: A6NKQ9, A4FVC8, A8MUK6
Gene ID:
Human(114335) Summary: The beta subunit of chorionic gonadotropin (CGB) is encoded by six highly homologous and structurally similar genes that are arranged in tandem and inverted pairs on chromosome 19q13.3, and contiguous with the luteinizing hormone beta (LHB) subunit gene. The CGB genes are primarily distinguished by differences in the 5' untranscribed region. This gene was originally thought to be one of the two pseudogenes (CGB1 and CGB2) of CGB subunit, however, detection of CGB1 and CGB2 transcripts in vivo, and their presence on the polysomes, suggested that these transcripts are translated. To date, a protein product corresponding to CGB1 has not been isolated. The deduced sequence of the hypothetical protein of 132 aa does not share any similarity with that of functional CGB subunits (PMID:8954017). However, a 155 aa protein, translated from a different frame, is about the same size, and shares 98% identity with other CGB subunits. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033377 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151634 predicted 318
2 SASI_Hs01_00151636 predicted 263
3 SASI_Hs01_00151639 predicted 486
4 SASI_Hs01_00151640 predicted 223
5 SASI_Hs01_00151641 predicted 309
6 SASI_Hs02_00361225 predicted 520
7 SASI_Hs02_00361226 predicted 607
8 SASI_Hs02_00361227 predicted 528
9 SASI_Hs02_00361228 predicted 524
10 SASI_Hs02_00361229 predicted 525
11 SASI_Hs01_00151632 predicted 205
12 SASI_Hs01_00151633 predicted 210
13 SASI_Hs01_00151635 predicted 213
14 SASI_Hs01_00151637 predicted 211
15 SASI_Hs01_00151638 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033377
CGB1 MISSION shRNA Bacterial Glycerol Stock
chorionic gonadotropin, beta polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-394s21c1
Sequence:CCGGCACCATGACCCGCGTGCTGCACTCGAGTGCAGCACGCGGGTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-447s21c1
Sequence:CCGGGCAACTACCGCGATGTGCGCTCTCGAGAGCGCACATCGCGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-325s21c1
Sequence:CCGGGGCTGTGGAGAAGGAGGGCTGCTCGAGCAGCCCTCCTTCTCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-471s21c1
Sequence:CCGGAGTCCATCCGGCTCCCTGGCTCTCGAGAGCCAGGGAGCCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-274s21c1
Sequence:CCGGGGCATCCAAGGAGCCGCTTCGCTCGAGCGAAGCGGCTCCTTGGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033377
CGB1 MISSION shRNA shRNA Plasmid DNA
chorionic gonadotropin, beta polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-394s21c1
Sequence:CCGGCACCATGACCCGCGTGCTGCACTCGAGTGCAGCACGCGGGTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-447s21c1
Sequence:CCGGGCAACTACCGCGATGTGCGCTCTCGAGAGCGCACATCGCGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-325s21c1
Sequence:CCGGGGCTGTGGAGAAGGAGGGCTGCTCGAGCAGCCCTCCTTCTCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-471s21c1
Sequence:CCGGAGTCCATCCGGCTCCCTGGCTCTCGAGAGCCAGGGAGCCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-274s21c1
Sequence:CCGGGGCATCCAAGGAGCCGCTTCGCTCGAGCGAAGCGGCTCCTTGGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033377
CGB1 MISSION shRNA Lentiviral Transduction Particles
chorionic gonadotropin, beta polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-394s21c1
Sequence:CCGGCACCATGACCCGCGTGCTGCACTCGAGTGCAGCACGCGGGTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-447s21c1
Sequence:CCGGGCAACTACCGCGATGTGCGCTCTCGAGAGCGCACATCGCGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-325s21c1
Sequence:CCGGGGCTGTGGAGAAGGAGGGCTGCTCGAGCAGCCCTCCTTCTCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-471s21c1
Sequence:CCGGAGTCCATCCGGCTCCCTGGCTCTCGAGAGCCAGGGAGCCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033377.1-274s21c1
Sequence:CCGGGGCATCCAAGGAGCCGCTTCGCTCGAGCGAAGCGGCTCCTTGGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks