EMAIL THIS PAGE TO A FRIEND

CGB2

chorionic gonadotropin, beta polypeptide 2

29 Gene Product Result for
Species: Human CGB2(114336)
UniProtKB ID: Q6NT52, B9ZVM5
Gene ID:
Human(114336) Summary: The beta subunit of chorionic gonadotropin (CGB) is encoded by six highly homologous and structurally similar genes that are arranged in tandem and inverted pairs on chromosome 19q13.3, and contiguous with the luteinizing hormone beta (LHB) subunit gene. The CGB genes are primarily distinguished by differences in the 5' untranscribed region. This gene was originally thought to be one of the two pseudogenes (CGB1 and CGB2) of CGB subunit, however, detection of CGB1 and CGB2 transcripts in vivo, and their presence on the polysomes, suggested that these transcripts are translated. To date, a protein product corresponding to CGB2 has not been isolated. The deduced sequence of the hypothetical protein of 132 aa does not share any similarity with that of functional CGB subunits (PMID:8954017). However, a 163 aa protein, translated from a different frame, is about the same size, and shares 98% identity with other CGB subunits. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033378 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209528 predicted 316
2 SASI_Hs01_00209529 predicted 262
3 SASI_Hs01_00209532 predicted 484
4 SASI_Hs01_00209533 predicted 314
5 SASI_Hs02_00361230 predicted 525
6 SASI_Hs01_00209534 predicted 521
7 SASI_Hs02_00361231 predicted 519
8 SASI_Hs02_00361232 predicted 519
9 SASI_Hs02_00361233 predicted 514
10 SASI_Hs02_00361234 predicted 517
11 SASI_Hs01_00209526 predicted 210
12 SASI_Hs01_00209527 predicted 216
13 SASI_Hs01_00209530 predicted 205
14 SASI_Hs01_00209531 predicted 203
15 SASI_Hs01_00209535 predicted 190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033378
CGB2 MISSION shRNA Bacterial Glycerol Stock
chorionic gonadotropin, beta polypeptide 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-263s21c1
Sequence:CCGGGGCGGGACATGGGCATCCAAGCTCGAGCTTGGATGCCCATGTCCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-370s21c1
Sequence:CCGGCACCATCTGTGCCGGCTACTGCTCGAGCAGTAGCCGGCACAGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-517s21c1
Sequence:CCGGCTCCTACGCCGTGGCTCTCAGCTCGAGCTGAGAGCCACGGCGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-311s21c1
Sequence:CCGGATCAATGCCACCCTGGCTGTGCTCGAGCACAGCCAGGGTGGCATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-539s21c1
Sequence:CCGGTGTCAATGTGCACTCTGCCGCCTCGAGGCGGCAGAGTGCACATTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033378
CGB2 MISSION shRNA shRNA Plasmid DNA
chorionic gonadotropin, beta polypeptide 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-263s21c1
Sequence:CCGGGGCGGGACATGGGCATCCAAGCTCGAGCTTGGATGCCCATGTCCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-370s21c1
Sequence:CCGGCACCATCTGTGCCGGCTACTGCTCGAGCAGTAGCCGGCACAGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-517s21c1
Sequence:CCGGCTCCTACGCCGTGGCTCTCAGCTCGAGCTGAGAGCCACGGCGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-311s21c1
Sequence:CCGGATCAATGCCACCCTGGCTGTGCTCGAGCACAGCCAGGGTGGCATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-539s21c1
Sequence:CCGGTGTCAATGTGCACTCTGCCGCCTCGAGGCGGCAGAGTGCACATTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033378
CGB2 MISSION shRNA Lentiviral Transduction Particles
chorionic gonadotropin, beta polypeptide 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-263s21c1
Sequence:CCGGGGCGGGACATGGGCATCCAAGCTCGAGCTTGGATGCCCATGTCCCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-370s21c1
Sequence:CCGGCACCATCTGTGCCGGCTACTGCTCGAGCAGTAGCCGGCACAGATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-517s21c1
Sequence:CCGGCTCCTACGCCGTGGCTCTCAGCTCGAGCTGAGAGCCACGGCGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-311s21c1
Sequence:CCGGATCAATGCCACCCTGGCTGTGCTCGAGCACAGCCAGGGTGGCATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033378.1-539s21c1
Sequence:CCGGTGTCAATGTGCACTCTGCCGCCTCGAGGCGGCAGAGTGCACATTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)