EMAIL THIS PAGE TO A FRIEND

CGB7

chorionic gonadotropin, beta polypeptide 7

Synonyms: CG-beta-a CGB6
Species: Human CGB7(94027)
Gene ID:
Human(94027) Summary: This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0094027M1 Monoclonal Anti-CGB7 antibody produced in mouse clone 6F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033142 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171179 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033142
CGB7 MISSION shRNA Bacterial Glycerol Stock
chorionic gonadotropin, beta polypeptide 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-583s21c1
Sequence:CCGGCTCAGGTGGTGTGCAACTACCCTCGAGGGTAGTTGCACACCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-676s21c1
Sequence:CCGGTGGCTCTCAGCTGTCAATGTGCTCGAGCACATTGACAGCTGAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-504s21c1
Sequence:CCGGATCACCGTCAACACCACCATCCTCGAGGATGGTGGTGTTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-606s21c1
Sequence:CCGGGATGTGCGCTTCGAGTCCATCCTCGAGGATGGACTCGAAGCGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-416s21c1
Sequence:CCGGGACATGGGCATCCAGGGAGATCTCGAGATCTCCCTGGATGCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-464s21c1
Sequence:CCGGTGCCACCCTGGCTGTGGAGAACTCGAGTTCTCCACAGCCAGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-517s21c1
Sequence:CCGGCCACCATCTGTGCCGGCTACTCTCGAGAGTAGCCGGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-543s21c1
Sequence:CCGGACCATGACCCGCGTGCTGCAGCTCGAGCTGCAGCACGCGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033142
CGB7 MISSION shRNA shRNA Plasmid DNA
chorionic gonadotropin, beta polypeptide 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-583s21c1
Sequence:CCGGCTCAGGTGGTGTGCAACTACCCTCGAGGGTAGTTGCACACCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-676s21c1
Sequence:CCGGTGGCTCTCAGCTGTCAATGTGCTCGAGCACATTGACAGCTGAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-504s21c1
Sequence:CCGGATCACCGTCAACACCACCATCCTCGAGGATGGTGGTGTTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-606s21c1
Sequence:CCGGGATGTGCGCTTCGAGTCCATCCTCGAGGATGGACTCGAAGCGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-416s21c1
Sequence:CCGGGACATGGGCATCCAGGGAGATCTCGAGATCTCCCTGGATGCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-464s21c1
Sequence:CCGGTGCCACCCTGGCTGTGGAGAACTCGAGTTCTCCACAGCCAGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-517s21c1
Sequence:CCGGCCACCATCTGTGCCGGCTACTCTCGAGAGTAGCCGGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-543s21c1
Sequence:CCGGACCATGACCCGCGTGCTGCAGCTCGAGCTGCAGCACGCGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033142
CGB7 MISSION shRNA Lentiviral Transduction Particles
chorionic gonadotropin, beta polypeptide 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-583s21c1
Sequence:CCGGCTCAGGTGGTGTGCAACTACCCTCGAGGGTAGTTGCACACCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-676s21c1
Sequence:CCGGTGGCTCTCAGCTGTCAATGTGCTCGAGCACATTGACAGCTGAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-504s21c1
Sequence:CCGGATCACCGTCAACACCACCATCCTCGAGGATGGTGGTGTTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-606s21c1
Sequence:CCGGGATGTGCGCTTCGAGTCCATCCTCGAGGATGGACTCGAAGCGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-416s21c1
Sequence:CCGGGACATGGGCATCCAGGGAGATCTCGAGATCTCCCTGGATGCCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-464s21c1
Sequence:CCGGTGCCACCCTGGCTGTGGAGAACTCGAGTTCTCCACAGCCAGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-517s21c1
Sequence:CCGGCCACCATCTGTGCCGGCTACTCTCGAGAGTAGCCGGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033142.1-543s21c1
Sequence:CCGGACCATGACCCGCGTGCTGCAGCTCGAGCTGCAGCACGCGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks