EMAIL THIS PAGE TO A FRIEND

CGB8

chorionic gonadotropin, beta polypeptide 8

3 Gene Product Result for
Species: Human CGB8(94115)
Gene ID:
Human(94115) Summary: This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 8 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033183 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033183
CGB8 MISSION shRNA Bacterial Glycerol Stock
chorionic gonadotropin, beta polypeptide 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-398s21c1
Sequence:CCGGTGTTGCTGCTGCTGAGCATGGCTCGAGCCATGCTCAGCAGCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-614s21c1
Sequence:CCGGATGTGCGCTTCGAGTCCATCCCTCGAGGGATGGACTCGAAGCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-512s21c1
Sequence:CCGGTCACCGTCAACACCACCATCTCTCGAGAGATGGTGGTGTTGACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-597s21c1
Sequence:CCGGGGTGTGCAACTACCGCGATGTCTCGAGACATCGCGGTAGTTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-682s21c1
Sequence:CCGGGTGGCTCTCAGCTGTCAATGTCTCGAGACATTGACAGCTGAGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033183
CGB8 MISSION shRNA shRNA Plasmid DNA
chorionic gonadotropin, beta polypeptide 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-398s21c1
Sequence:CCGGTGTTGCTGCTGCTGAGCATGGCTCGAGCCATGCTCAGCAGCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-614s21c1
Sequence:CCGGATGTGCGCTTCGAGTCCATCCCTCGAGGGATGGACTCGAAGCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-512s21c1
Sequence:CCGGTCACCGTCAACACCACCATCTCTCGAGAGATGGTGGTGTTGACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-597s21c1
Sequence:CCGGGGTGTGCAACTACCGCGATGTCTCGAGACATCGCGGTAGTTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-682s21c1
Sequence:CCGGGTGGCTCTCAGCTGTCAATGTCTCGAGACATTGACAGCTGAGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033183
CGB8 MISSION shRNA Lentiviral Transduction Particles
chorionic gonadotropin, beta polypeptide 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-398s21c1
Sequence:CCGGTGTTGCTGCTGCTGAGCATGGCTCGAGCCATGCTCAGCAGCAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-614s21c1
Sequence:CCGGATGTGCGCTTCGAGTCCATCCCTCGAGGGATGGACTCGAAGCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-512s21c1
Sequence:CCGGTCACCGTCAACACCACCATCTCTCGAGAGATGGTGGTGTTGACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-597s21c1
Sequence:CCGGGGTGTGCAACTACCGCGATGTCTCGAGACATCGCGGTAGTTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033183.2-682s21c1
Sequence:CCGGGTGGCTCTCAGCTGTCAATGTCTCGAGACATTGACAGCTGAGAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks