EMAIL THIS PAGE TO A FRIEND

CGB

chorionic gonadotropin, beta polypeptide

14 Gene Product Result for
Synonyms: CGB3 CGB5 CGB7 CGB8 hCGB
Species: Human CGB(1082)
Gene ID:
Human(1082) Summary: This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405609 Anti-CGB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410130 Anti-CGB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA038925 Anti-CGB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA038934 Anti-CGB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
C8534 Anti-Chorionic Gonadotropin (α+β subunits) (HCG) antibody produced in rabbit whole antiserum human
immunohistochemistry, radioimmunoassay pricing
GW20075F Anti-Chorionic Gonadotropin β subunit (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
GW22389F Anti-Chorionic Gonadotropin β Subunit (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500168 Anti-HCG β, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB1402721 Monoclonal Anti-CGB, (C-terminal) antibody produced in mouse clone 3B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
G5270 Gonadotropin from human menopausal urine human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000737
CGB MISSION shRNA Bacterial Glycerol Stock
chorionic gonadotropin, beta polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-503s1c1
Sequence:CCGGCATCACCGTCAACACCACCATCTCGAGATGGTGGTGTTGACGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-496s1c1
Sequence:CCGGCCGTGTGCATCACCGTCAACACTCGAGTGTTGACGGTGATGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-588s1c1
Sequence:CCGGGTGGTGTGCAACTACCGCGATCTCGAGATCGCGGTAGTTGCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-673s1c1
Sequence:CCGGCCGTGGCTCTCAGCTGTCAATCTCGAGATTGACAGCTGAGAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-605s1c1
Sequence:CCGGCGATGTGCGCTTCGAGTCCATCTCGAGATGGACTCGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000737
CGB MISSION shRNA shRNA Plasmid DNA
chorionic gonadotropin, beta polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-503s1c1
Sequence:CCGGCATCACCGTCAACACCACCATCTCGAGATGGTGGTGTTGACGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-496s1c1
Sequence:CCGGCCGTGTGCATCACCGTCAACACTCGAGTGTTGACGGTGATGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-588s1c1
Sequence:CCGGGTGGTGTGCAACTACCGCGATCTCGAGATCGCGGTAGTTGCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-673s1c1
Sequence:CCGGCCGTGGCTCTCAGCTGTCAATCTCGAGATTGACAGCTGAGAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-605s1c1
Sequence:CCGGCGATGTGCGCTTCGAGTCCATCTCGAGATGGACTCGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000737
CGB MISSION shRNA Lentiviral Transduction Particles
chorionic gonadotropin, beta polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-503s1c1
Sequence:CCGGCATCACCGTCAACACCACCATCTCGAGATGGTGGTGTTGACGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-496s1c1
Sequence:CCGGCCGTGTGCATCACCGTCAACACTCGAGTGTTGACGGTGATGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-588s1c1
Sequence:CCGGGTGGTGTGCAACTACCGCGATCTCGAGATCGCGGTAGTTGCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-673s1c1
Sequence:CCGGCCGTGGCTCTCAGCTGTCAATCTCGAGATTGACAGCTGAGAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000737.2-605s1c1
Sequence:CCGGCGATGTGCGCTTCGAGTCCATCTCGAGATGGACTCGAAGCGCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks