EMAIL THIS PAGE TO A FRIEND

CGGBP1

CGG triplet repeat binding protein 1

225 Gene Product Result for
Synonyms: CGGBP p20-CGGBP
UniProtKB ID: Q9UFW8, D3DU38, O15183
Gene ID:
Human(8545) Summary: CGGBP1 influences expression of the FMR1 gene (MIM 309550), which is associated with the fragile X mental retardation syndrome (MIM 300624), by specifically interacting with the 5-prime (CGG)n-3-prime repeat in its 5-prime UTR.[supplied by OMIM, Mar 2008]
Mouse(106143) CGG triplet repeat binding protein 1
Rat(288353) CGG triplet repeat binding protein 1
chicken(770224) CGG triplet repeat binding protein 1
domestic cat(101100582) CGG triplet repeat binding protein 1
cow(613824) CGG triplet repeat binding protein 1
dog(478375) CGG triplet repeat binding protein 1
naked mole-rat(101719300) CGG triplet repeat binding protein 1
sheep(101121901) CGG triplet repeat binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012151 MISSION® esiRNA esiRNA targeting human CGGBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008390 Rosetta Predictions human pricing
NM_003663 Rosetta Predictions human pricing
NM_001105900 Rosetta Predictions rat pricing
NM_178647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102500 predicted 1410
2 SASI_Hs01_00102501 predicted 1421
3 SASI_Hs01_00102502 predicted 1503
4 SASI_Hs01_00102503 predicted 1409
5 SASI_Hs01_00102504 predicted 888
6 SASI_Hs01_00102505 predicted 791
7 SASI_Hs01_00102506 predicted 845
8 SASI_Hs01_00102507 predicted 783
9 SASI_Hs01_00102508 predicted 1402
10 SASI_Hs01_00102509 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163654 predicted 1306
2 SASI_Hs01_00163655 predicted 1322
3 SASI_Hs01_00163656 predicted 1403
4 SASI_Hs01_00163657 predicted 1305
5 SASI_Hs01_00163658 predicted 785
6 SASI_Hs01_00163659 predicted 687
7 SASI_Hs01_00163660 predicted 743
8 SASI_Hs01_00163661 predicted 680
9 SASI_Hs01_00163662 predicted 1304
10 SASI_Hs01_00163663 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213642 predicted 903
2 SASI_Rn02_00213643 predicted 516
3 SASI_Rn02_00213644 predicted 548
4 SASI_Rn02_00213645 predicted 831
5 SASI_Rn02_00213646 predicted 762
6 SASI_Rn02_00213647 predicted 640
7 SASI_Rn02_00213648 predicted 688
8 SASI_Rn02_00213649 predicted 867
9 SASI_Rn02_00213650 predicted 537
10 SASI_Rn02_00213651 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349057 predicted 1399
2 SASI_Mm01_00107410 predicted 1119
3 SASI_Mm01_00107411 predicted 1324
4 SASI_Mm01_00107413 predicted 1256
5 SASI_Mm01_00107414 predicted 1356
6 SASI_Mm01_00107417 predicted 1385
7 SASI_Mm01_00107418 predicted 1396
8 SASI_Mm02_00349058 predicted 1394
9 SASI_Mm02_00349059 predicted 1367
10 SASI_Mm02_00349060 predicted 1251
11 SASI_Mm01_00107409 predicted 920
12 SASI_Mm01_00107412 predicted 1172
13 SASI_Mm01_00107415 predicted 888
14 SASI_Mm01_00107416 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003663
VALIDATED
CGGBP1 MISSION shRNA Bacterial Glycerol Stock
CGG triplet repeat binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-844s21c1
Sequence:CCGGAGCTACGGAGGGCATATCTTCCTCGAGGAAGATATGCCCTCCGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-939s21c1
Sequence:CCGGCAAGATAAATGTGGAGTATTACTCGAGTAATACTCCACATTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-871s21c1
Sequence:CCGGGATATGAGAATGAGAATCAACCTCGAGGTTGATTCTCATTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-1247s21c1
Sequence:CCGGATTCCTTGTGAGATTACTTAACTCGAGTTAAGTAATCTCACAAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-906s21c1
Sequence:CCGGGATTGTTGACTAGGAGGTTACCTCGAGGTAACCTCCTAGTCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-391s1c1
Sequence:CCGGGAAACCGTTCTAAGACTGCCTCTCGAGAGGCAGTCTTAGAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-610s1c1
Sequence:CCGGCCCTAACTGCATCTCTTCAGTCTCGAGACTGAAGAGATGCAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-455s1c1
Sequence:CCGGGCTGCATGAAGATGGAGGAAACTCGAGTTTCCTCCATCTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-487s1c1
Sequence:CCGGCTTCTTGCAATGTGGTTCTGACTCGAGTCAGAACCACATTGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-642s1c1
Sequence:CCGGGCGCAAACAGAGAAAGTCAGTCTCGAGACTGACTTTCTCTGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003663
VALIDATED
CGGBP1 MISSION shRNA shRNA Plasmid DNA
CGG triplet repeat binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-844s21c1
Sequence:CCGGAGCTACGGAGGGCATATCTTCCTCGAGGAAGATATGCCCTCCGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-939s21c1
Sequence:CCGGCAAGATAAATGTGGAGTATTACTCGAGTAATACTCCACATTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-871s21c1
Sequence:CCGGGATATGAGAATGAGAATCAACCTCGAGGTTGATTCTCATTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-1247s21c1
Sequence:CCGGATTCCTTGTGAGATTACTTAACTCGAGTTAAGTAATCTCACAAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-906s21c1
Sequence:CCGGGATTGTTGACTAGGAGGTTACCTCGAGGTAACCTCCTAGTCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-391s1c1
Sequence:CCGGGAAACCGTTCTAAGACTGCCTCTCGAGAGGCAGTCTTAGAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-610s1c1
Sequence:CCGGCCCTAACTGCATCTCTTCAGTCTCGAGACTGAAGAGATGCAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-455s1c1
Sequence:CCGGGCTGCATGAAGATGGAGGAAACTCGAGTTTCCTCCATCTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-487s1c1
Sequence:CCGGCTTCTTGCAATGTGGTTCTGACTCGAGTCAGAACCACATTGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-642s1c1
Sequence:CCGGGCGCAAACAGAGAAAGTCAGTCTCGAGACTGACTTTCTCTGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003663
VALIDATED
CGGBP1 MISSION shRNA Lentiviral Transduction Particles
CGG triplet repeat binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-844s21c1
Sequence:CCGGAGCTACGGAGGGCATATCTTCCTCGAGGAAGATATGCCCTCCGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-939s21c1
Sequence:CCGGCAAGATAAATGTGGAGTATTACTCGAGTAATACTCCACATTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-871s21c1
Sequence:CCGGGATATGAGAATGAGAATCAACCTCGAGGTTGATTCTCATTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003663.3-1247s21c1
Sequence:CCGGATTCCTTGTGAGATTACTTAACTCGAGTTAAGTAATCTCACAAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003663.3-906s21c1
Sequence:CCGGGATTGTTGACTAGGAGGTTACCTCGAGGTAACCTCCTAGTCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-391s1c1
Sequence:CCGGGAAACCGTTCTAAGACTGCCTCTCGAGAGGCAGTCTTAGAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-610s1c1
Sequence:CCGGCCCTAACTGCATCTCTTCAGTCTCGAGACTGAAGAGATGCAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-455s1c1
Sequence:CCGGGCTGCATGAAGATGGAGGAAACTCGAGTTTCCTCCATCTTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003663.2-487s1c1
Sequence:CCGGCTTCTTGCAATGTGGTTCTGACTCGAGTCAGAACCACATTGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003663.2-642s1c1
Sequence:CCGGGCGCAAACAGAGAAAGTCAGTCTCGAGACTGACTTTCTCTGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178647
VALIDATED
CGGBP1 MISSION shRNA Bacterial Glycerol Stock
CGG triplet repeat binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-701s1c1
Sequence:CCGGAGCCAGTGTTATCCAGGACTTCTCGAGAAGTCCTGGATAACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-436s1c1
Sequence:CCGGGAAATCGTTCTAAGACTGCTTCTCGAGAAGCAGTCTTAGAACGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-555s1c1
Sequence:CCGGCATGTTCGCAAGTCTGCCATTCTCGAGAATGGCAGACTTGCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-581s1c1
Sequence:CCGGCCACCTCAAGTCAAAGACTCACTCGAGTGAGTCTTTGACTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178647.2-2433s1c1
Sequence:CCGGGCCCAGCAATAATTTGTGTTTCTCGAGAAACACAAATTATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178647
VALIDATED
CGGBP1 MISSION shRNA shRNA Plasmid DNA
CGG triplet repeat binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-701s1c1
Sequence:CCGGAGCCAGTGTTATCCAGGACTTCTCGAGAAGTCCTGGATAACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-436s1c1
Sequence:CCGGGAAATCGTTCTAAGACTGCTTCTCGAGAAGCAGTCTTAGAACGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-555s1c1
Sequence:CCGGCATGTTCGCAAGTCTGCCATTCTCGAGAATGGCAGACTTGCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-581s1c1
Sequence:CCGGCCACCTCAAGTCAAAGACTCACTCGAGTGAGTCTTTGACTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178647.2-2433s1c1
Sequence:CCGGGCCCAGCAATAATTTGTGTTTCTCGAGAAACACAAATTATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178647
VALIDATED
CGGBP1 MISSION shRNA Lentiviral Transduction Particles
CGG triplet repeat binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-701s1c1
Sequence:CCGGAGCCAGTGTTATCCAGGACTTCTCGAGAAGTCCTGGATAACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-436s1c1
Sequence:CCGGGAAATCGTTCTAAGACTGCTTCTCGAGAAGCAGTCTTAGAACGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178647.2-555s1c1
Sequence:CCGGCATGTTCGCAAGTCTGCCATTCTCGAGAATGGCAGACTTGCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178647.2-581s1c1
Sequence:CCGGCCACCTCAAGTCAAAGACTCACTCGAGTGAGTCTTTGACTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178647.2-2433s1c1
Sequence:CCGGGCCCAGCAATAATTTGTGTTTCTCGAGAAACACAAATTATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks